ID: 998342528

View in Genome Browser
Species Human (GRCh38)
Location 5:141430987-141431009
Sequence AGCTGCCGCTGCGCGGATTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 3, 3: 1, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998342528_998342535 3 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342535 5:141431013-141431035 TCACGGCGGGCAGGATAGACCGG 0: 1
1: 4
2: 4
3: 6
4: 62
998342528_998342539 20 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342539 5:141431030-141431052 GACCGGGAGGAGCTCTGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 58
998342528_998342536 4 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342536 5:141431014-141431036 CACGGCGGGCAGGATAGACCGGG 0: 1
1: 4
2: 4
3: 7
4: 98
998342528_998342542 22 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342542 5:141431032-141431054 CCGGGAGGAGCTCTGTATGGGGG 0: 1
1: 0
2: 0
3: 20
4: 265
998342528_998342538 19 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342538 5:141431029-141431051 AGACCGGGAGGAGCTCTGTATGG 0: 1
1: 1
2: 0
3: 7
4: 80
998342528_998342534 -6 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342534 5:141431004-141431026 GCAGCTTGGTCACGGCGGGCAGG 0: 1
1: 2
2: 4
3: 14
4: 120
998342528_998342540 21 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342540 5:141431031-141431053 ACCGGGAGGAGCTCTGTATGGGG 0: 1
1: 0
2: 0
3: 7
4: 97
998342528_998342533 -10 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342533 5:141431000-141431022 AGCGGCAGCTTGGTCACGGCGGG 0: 1
1: 3
2: 5
3: 3
4: 51
998342528_998342537 7 Left 998342528 5:141430987-141431009 CCTGAATCCGCGCAGCGGCAGCT 0: 1
1: 0
2: 3
3: 1
4: 50
Right 998342537 5:141431017-141431039 GGCGGGCAGGATAGACCGGGAGG 0: 1
1: 3
2: 4
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998342528 Original CRISPR AGCTGCCGCTGCGCGGATTC AGG (reversed) Exonic
901057803 1:6456886-6456908 ACCTGCCTCTGCGGGGAATCAGG + Intronic
906962199 1:50425546-50425568 GGCGGCCCCTGCGCGGAATCCGG - Intergenic
909358393 1:74733811-74733833 AGCTGTTGATGAGCGGATTCCGG - Intronic
911892514 1:103390199-103390221 TGCTGCCTCTGTGCCGATTCAGG + Intergenic
913937289 1:125066129-125066151 AGCCACCGCTGCGCGGAGACAGG - Intergenic
915936682 1:160093782-160093804 CACTGCCGCTGAGTGGATTCAGG - Exonic
918208282 1:182328715-182328737 AGCTGCGGCTGTGTGGGTTCAGG + Intergenic
919311651 1:195917343-195917365 AGCTGGAGCTGCTGGGATTCAGG - Intergenic
1067330083 10:45307143-45307165 AGCTGCAGCTGTGCTGACTCTGG - Intronic
1073287497 10:102397523-102397545 AGCTCCCGCTGCTCGGCCTCTGG - Exonic
1075396789 10:122133395-122133417 AGCTGACTCTGAGCTGATTCTGG - Intronic
1076994538 11:291701-291723 AGCTGCCCATGCGCATATTCGGG + Intronic
1077101556 11:824767-824789 AGCTGGTGCTGCGGGGATGCTGG - Exonic
1077113177 11:870802-870824 AGCAGCCGCTGCGCGGCCTGAGG - Intronic
1102035165 12:109766793-109766815 AGATGCCCCTGCCCGGCTTCGGG - Intronic
1105239734 13:18598674-18598696 AGCTGCCGCTCAGCCTATTCTGG - Intergenic
1105447490 13:20470318-20470340 AGCGGCCGCTGCCTGCATTCTGG - Intronic
1111213942 13:85118970-85118992 AGCTGCCCATGGGTGGATTCAGG + Intergenic
1118633629 14:67727921-67727943 AGCTGCCACTGCCTGGACTCAGG + Intronic
1124109593 15:26773356-26773378 AGCCGCGGCTGCGCGGAGTCGGG + Intronic
1124392266 15:29269745-29269767 AGCAGCCGCGGCGGGGATTGCGG + Exonic
1127026656 15:54814692-54814714 AGCTGCAGCTGCTGGGATGCAGG - Intergenic
1142594013 17:1020887-1020909 AGCTCCCCGTGCTCGGATTCAGG + Intronic
1143731309 17:8884457-8884479 GGCTGCTGCTGAGCGCATTCGGG + Intronic
1147599155 17:41734959-41734981 AGCTGCCGCGCCGGGGTTTCGGG + Intergenic
1149610546 17:57955413-57955435 AGCTGTCCCTGCGCGGCTGCCGG + Intergenic
1154449095 18:14460100-14460122 AGCTGCCGCTCAGCCTATTCTGG + Intergenic
1160417807 18:78723730-78723752 ATCTGTCACTGCGCGGAGTCAGG + Intergenic
1202638252 1_KI270706v1_random:60333-60355 AGCTGCGGCTGCTGGGATGCAGG + Intergenic
936385543 2:112025279-112025301 AGCTGCAGTTGCGTGGACTCAGG + Intronic
938447359 2:131389287-131389309 AGCTGCCACTGCTCTGAGTCTGG + Intergenic
939668737 2:144982643-144982665 AGCTGCCTCTGCTATGATTCAGG - Intergenic
949078547 2:242077748-242077770 AGCTGCCACTCCGCAGACTCAGG - Intergenic
1185381211 22:50508140-50508162 AGCTCCCGCTGCGCGGCGCCGGG + Intergenic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
954926004 3:54235348-54235370 AGCTGCATCTGCTCGGCTTCTGG + Intronic
955916248 3:63911828-63911850 AGCCGCCGCAGAGCGGACTCCGG - Intronic
975710787 4:77157977-77157999 CGCTGCTGCAGCGCCGATTCCGG - Intronic
982437868 4:155399019-155399041 AGCTCCCCCTGCACGGCTTCAGG + Intergenic
1202765591 4_GL000008v2_random:146191-146213 AGCTGCGGCTGCTGGGATGCAGG + Intergenic
996239040 5:121171555-121171577 AGCTGGTGCTGCCAGGATTCAGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
1001931837 5:175678665-175678687 AGCGGTCGCTGCGTGGATGCAGG + Intronic
1007992253 6:46269641-46269663 AGCTGCAGCTGTGCAGATACAGG + Intronic
1025296188 7:57776713-57776735 AGCGGCGGCTGCGGGGACTCGGG - Intergenic
1034095086 7:148400267-148400289 TGCTGCCGCCACGCGCATTCTGG + Intronic
1038425466 8:27461510-27461532 AGGTGCCTCTCCGCGGAGTCTGG - Exonic
1047941468 8:129830950-129830972 AGCTGGAGCTGCTGGGATTCAGG + Intergenic
1053145861 9:35711720-35711742 AGCTGCTGCTGGGCTGAATCAGG - Exonic
1057161401 9:92890882-92890904 AGCTGGAGCTGCACGGATGCAGG + Intergenic
1057675951 9:97136088-97136110 AGCTGGCGCTGCAGGGATGCAGG + Intergenic
1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG + Intronic