ID: 998343453

View in Genome Browser
Species Human (GRCh38)
Location 5:141439718-141439740
Sequence AATTATAAGCAGGAACGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998343449_998343453 1 Left 998343449 5:141439694-141439716 CCTATTATGGCTCCTAGTTCTAC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG 0: 1
1: 0
2: 1
3: 15
4: 186
998343448_998343453 11 Left 998343448 5:141439684-141439706 CCACAACATTCCTATTATGGCTC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG 0: 1
1: 0
2: 1
3: 15
4: 186
998343447_998343453 12 Left 998343447 5:141439683-141439705 CCCACAACATTCCTATTATGGCT 0: 1
1: 0
2: 1
3: 10
4: 129
Right 998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG 0: 1
1: 0
2: 1
3: 15
4: 186
998343445_998343453 23 Left 998343445 5:141439672-141439694 CCAAGAGCAGACCCACAACATTC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998343453 Original CRISPR AATTATAAGCAGGAACGGAA CGG Intronic
902129884 1:14251048-14251070 AATTACCAGCAGGAAAGAAAGGG + Intergenic
902492353 1:16793426-16793448 AAATATTATCAGGAATGGAAAGG - Intronic
902956160 1:19925311-19925333 AGTTATTAGCAGGAAATGAATGG - Intergenic
904966791 1:34380380-34380402 AAATATGAACAGGAAAGGAAAGG + Intergenic
904990486 1:34588865-34588887 AATTATTTGCAGGAACAGCAGGG - Intergenic
909312916 1:74175908-74175930 AATTATAAACAGGAGTGTAAAGG - Intronic
909586140 1:77290897-77290919 AAATATAAGCAGGAGCACAATGG + Intronic
910781731 1:90943968-90943990 TATAATAAGTGGGAACGGAAAGG - Intronic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
911611555 1:99963887-99963909 ATTTGTAAGCAGGAATGGAAAGG - Intergenic
912202237 1:107471361-107471383 AATTAAAAGCAGGAAAGCAAGGG + Intronic
913405386 1:118485238-118485260 AATTAAGAGCAGAAAAGGAAGGG + Intergenic
916576628 1:166072721-166072743 AATTCTAAGAAGGAACTCAAAGG - Intronic
916661883 1:166929828-166929850 AATTTTGATCAGGAAGGGAAAGG + Intronic
919356432 1:196528911-196528933 AATCATAAGCATGAAAGGCATGG - Intronic
919664972 1:200283041-200283063 AGTTACACGCAGGAATGGAAGGG + Intergenic
919901841 1:202049625-202049647 AATGAAAAGAAGGAAAGGAAAGG + Intergenic
920131644 1:203736662-203736684 AATGATGACCAGGAAGGGAAGGG + Intronic
922136266 1:222830314-222830336 AATAAAAAGAAGGAAAGGAAGGG - Intergenic
922307338 1:224355991-224356013 AATTGAAATCAGGAAGGGAAGGG + Intergenic
922636010 1:227171950-227171972 AATGATAAAAAGGAACCGAATGG - Intronic
923528094 1:234789111-234789133 AAATATTATCAGGAATGGAAAGG + Intergenic
1064514924 10:16136681-16136703 ACTTATAAGTGGGAACTGAATGG - Intergenic
1066237143 10:33496494-33496516 AATTAGAAACAGAAACGGAATGG - Intergenic
1066668551 10:37812375-37812397 GATTAAAGGCAGGAAGGGAAAGG + Intronic
1071035866 10:81244608-81244630 AATTAAAAGCAGGAAATCAATGG + Intergenic
1072448439 10:95519571-95519593 AATTTTAAGCAAGAGCAGAAGGG + Intronic
1073714476 10:106087257-106087279 TTTTTTAAGCAGGAAAGGAAAGG - Intergenic
1074849047 10:117424173-117424195 AATTATAAGAAAGAAAGAAAAGG - Intergenic
1078275227 11:9838234-9838256 AGTTATTAGCAGGAAGGAAATGG - Intronic
1079152683 11:17914935-17914957 CAGTAAAAGCAGGAAAGGAATGG + Intronic
1081362696 11:42199926-42199948 ACTTATAAGAAGGAACTTAATGG + Intergenic
1087337633 11:96864466-96864488 AATTATAAAAAAGAACCGAATGG - Intergenic
1088652620 11:111971881-111971903 AATTATAAGTAAGAACATAATGG - Intronic
1088709062 11:112490357-112490379 ACATATAAGCAGGAAAGTAAAGG - Intergenic
1089113046 11:116072212-116072234 AATTAGAAGCAGACAGGGAAAGG - Intergenic
1089576449 11:119447770-119447792 AATCATGAGCAGGAAGAGAAGGG + Intergenic
1089642077 11:119854362-119854384 CATTATGAGCAGGAATGGAGTGG - Intergenic
1091673767 12:2472448-2472470 AACTATAAAAAGGAACAGAATGG - Intronic
1092862608 12:12732035-12732057 ACTTAAAAGCAGGAATGGATGGG - Intronic
1093895951 12:24574452-24574474 AAGTGTAAGCAGGGAAGGAAGGG + Intergenic
1095764932 12:45884668-45884690 AATTATTAGGAGGAAAGGAAAGG + Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1101141379 12:101799502-101799524 GATTTAAAGCAGGAAGGGAAGGG + Intronic
1102902258 12:116647470-116647492 ATTTAAAAGAAGGAAAGGAAGGG - Intergenic
1104621591 12:130317955-130317977 AACTTGAAGCAGCAACGGAAAGG + Intergenic
1106328027 13:28713344-28713366 AATCAAAAGCTGGAATGGAAAGG + Exonic
1107124724 13:36834216-36834238 AATTTTAAAAAGGAACAGAAGGG - Intergenic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108975029 13:56430900-56430922 AATTATAAAAAGGAACCAAATGG + Intergenic
1112212372 13:97391332-97391354 AATAATCAGCAGAAACGGAATGG + Exonic
1114430260 14:22654722-22654744 AATTGTAAGCACTAAAGGAAAGG + Intergenic
1114437481 14:22719354-22719376 AGTGATAAGCAGGAAGGAAAGGG + Intergenic
1114547285 14:23512359-23512381 AATCAAAAGCAGGCAGGGAAGGG + Intergenic
1114577275 14:23726337-23726359 AATCCCAAGCAGGAACGCAAAGG + Intergenic
1116009378 14:39333003-39333025 AATTATAAAAAGGAACCAAATGG - Intronic
1117378383 14:55136370-55136392 ACTTCTAAGAAGGAAAGGAAAGG - Intronic
1118039540 14:61902051-61902073 AATTATAAGCAGGTCTGGAACGG - Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1124348906 15:28941376-28941398 ACTGATTTGCAGGAACGGAAAGG + Intronic
1125680130 15:41525282-41525304 AATAATAAGAAGGAAGGGCAGGG - Intronic
1127560530 15:60132315-60132337 AATTATGAGGAAGAATGGAAGGG + Intergenic
1127990732 15:64114273-64114295 TAATAAAAGCAGGAAAGGAAAGG + Intronic
1131238637 15:90718869-90718891 ACCTATGAGCAGGAAGGGAAGGG + Intronic
1133101736 16:3484227-3484249 AATAATAAGCAGGAAAGAGAGGG + Intronic
1133641793 16:7724256-7724278 AAACATAAGGAGGAAGGGAATGG - Intergenic
1137091261 16:36194239-36194261 AATCATAAGAAGGAATCGAATGG - Intergenic
1138580319 16:57936878-57936900 AATTTTAGGCAGGAAGAGAAGGG + Intronic
1139382309 16:66540492-66540514 AAGTAAAAACAGGAAAGGAAGGG + Intronic
1142645547 17:1311972-1311994 AATTATAGGCAGGAAAAAAATGG - Intergenic
1143737294 17:8921283-8921305 ACTTATAAGTAGGAATGGTAGGG - Intronic
1153127781 18:1816896-1816918 AATTATAAAAAGGAACCAAATGG - Intergenic
1153631637 18:7076038-7076060 AATACTAACCAGGAAAGGAAAGG + Intronic
1155179864 18:23335079-23335101 AATTTTAAGCAGGAAAAAAATGG + Intronic
1156974704 18:43206394-43206416 AATTATAAGAAAGAACAAAATGG - Intergenic
1157013877 18:43685414-43685436 AATAATAATCAGCAATGGAATGG + Intergenic
1158710554 18:59833771-59833793 TATTATAAGAAGGAAGGGAATGG - Intergenic
1159623576 18:70667447-70667469 AACAATAAGGAGGAAGGGAAGGG - Intergenic
1166607281 19:44155505-44155527 AATTATAAGGAGGAAGAGGAGGG + Intronic
1166649472 19:44561210-44561232 GATAATTAGCAGGGACGGAAAGG + Intergenic
925827437 2:7863244-7863266 AAAAATAAGCAGGATAGGAAAGG + Intergenic
926711284 2:15883475-15883497 AATTAAAAGAAGAAAAGGAAGGG + Intergenic
928275564 2:29897448-29897470 AATTGTAAAGAGGAAGGGAAGGG + Intronic
928414603 2:31081426-31081448 AAAAATAAGCAGGAAGGAAAGGG + Intronic
931346773 2:61454118-61454140 AATTATAGGCAGGAAAAGAGAGG + Intronic
931826896 2:66009843-66009865 ATTTATAAGCAGGAAAGGCCTGG - Intergenic
932078108 2:68685325-68685347 AAATATAAGCAAGAACTAAAGGG + Intronic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933442614 2:82333168-82333190 AATTATATGTAAGAACTGAATGG + Intergenic
933783084 2:85815150-85815172 AAATAAAAGCAGGAAAGGAAAGG + Intergenic
934607966 2:95712334-95712356 AATTTTCAGCAAGAAGGGAAAGG - Intergenic
934965721 2:98720081-98720103 AATTTTAAGAAAGAACGAAATGG + Intronic
935458059 2:103293422-103293444 AATTAATAGCAGGAGCGGATCGG - Intergenic
935816263 2:106848843-106848865 AATTATTTGCAGGAACAAAAAGG - Intronic
936541307 2:113354222-113354244 AATTTTCAGCAAGAAGGGAAAGG - Intergenic
936560866 2:113538823-113538845 AAGTATAAGCATGAATAGAAAGG + Intergenic
939884882 2:147670794-147670816 AATCTTAATCAGGAAAGGAAGGG - Intergenic
941553817 2:166950350-166950372 AATTAAATACACGAACGGAAAGG - Intronic
941631917 2:167893846-167893868 AATTATAAGAAAGAACCAAATGG - Intergenic
944483636 2:200181338-200181360 AAATAGAAGCAGGCAGGGAAGGG - Intergenic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
946434986 2:219645422-219645444 AATTCTGAGCAGCAAAGGAAAGG + Intergenic
947510856 2:230753123-230753145 AAATAGATGCAGGAAAGGAAAGG + Intronic
1169781229 20:9312772-9312794 AATTTTACGTAGGAAAGGAAAGG + Intronic
1170181031 20:13530266-13530288 AATTAGAAGCAAGAACTGAGCGG + Intronic
1170342607 20:15346222-15346244 AATTATAGGCATGAACCAAAAGG + Intronic
1175616170 20:60400615-60400637 AATAATAATCAGGAAAGGAAAGG - Intergenic
1184001820 22:41680255-41680277 AACTATAAGCAGCTTCGGAAAGG - Exonic
949221149 3:1635552-1635574 AATTATGAGCAAGAAAGAAAAGG - Intergenic
953761606 3:45691883-45691905 AATTGTAAGCAGGAAAGTAGAGG - Intronic
957709958 3:83843439-83843461 AATTACAAACAGGAAGGGGAGGG - Intergenic
959102071 3:102022122-102022144 TATTATAAGCAGAAATGCAAAGG - Intergenic
959946585 3:112131797-112131819 AATTTTAAGCATGAATGCAATGG + Intronic
961056053 3:123789671-123789693 AAAAAAAAGAAGGAACGGAAGGG + Intronic
962036395 3:131656149-131656171 AGTTAGAAGAAGGAAAGGAAGGG - Intronic
963223011 3:142831718-142831740 ACTTATAAGCAGCAAAGGAAAGG + Intronic
966666299 3:182475109-182475131 TAATATAAGCAGTAACGGAAAGG + Intergenic
967516335 3:190373151-190373173 AAGTATAAGGAGAAAGGGAAGGG - Intronic
967986897 3:195101923-195101945 AAATGTAAGGAGGAAGGGAAGGG + Intronic
970562209 4:17293285-17293307 AGTGATAAGAAGGAATGGAAAGG - Intergenic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
970903060 4:21182459-21182481 TATTATTAGAAGGAAAGGAAAGG - Intronic
971012567 4:22454762-22454784 AATTATAAGTAGCAACTGTAGGG - Intronic
974329519 4:60459532-60459554 ATTTCTAAGCAGTAACAGAATGG + Intergenic
978273973 4:106926445-106926467 TTTTATAGGCAGGAACTGAAAGG - Intronic
979505401 4:121489890-121489912 GATTATAAGGAGGAGCTGAAAGG + Intergenic
980316913 4:131213486-131213508 AATTATAAGCAGGATTAGACTGG + Intergenic
980562835 4:134500828-134500850 AATTATACTCAGCAACAGAAAGG - Intergenic
981433356 4:144688764-144688786 AGTTATATGCAAGAACGGAAGGG + Intronic
983365323 4:166779450-166779472 AATTATAAGAATGAACTAAATGG + Intronic
983648876 4:170019234-170019256 AATTTCAAGAAGGAACAGAAAGG + Intronic
987284074 5:16438667-16438689 AATTATTATCATGAATGGAAAGG - Intergenic
988180634 5:27786838-27786860 AACTATCAGCTGGAACTGAAGGG - Intergenic
989022563 5:37026578-37026600 AATTAAAAACAGGGAGGGAAAGG + Intronic
989543371 5:42643670-42643692 AAATATTAGCATGAATGGAAGGG + Intronic
991004053 5:61810564-61810586 AATTATAAGCAGAAACAGCTGGG + Intergenic
991528513 5:67590904-67590926 AATTATAATCAGCTACGGAAAGG + Intergenic
992698109 5:79311318-79311340 AAGTATGAGCAGGGACGTAAGGG - Intronic
993953949 5:94209633-94209655 AATTATAAACAGGTAAAGAAAGG - Intronic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
1000383980 5:160656271-160656293 AATTATAAACCAGAAAGGAAAGG - Intronic
1000464450 5:161558437-161558459 AATTATAAGCAAGAATGGCTAGG + Intronic
1000845705 5:166277562-166277584 AAATATAGACAGGAAGGGAAAGG - Intergenic
1002437914 5:179243845-179243867 AATTATAAACAAGAACCAAATGG + Intronic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1003186852 6:3839541-3839563 CACTATAAGCAGGAACAGAATGG - Intergenic
1003189935 6:3865697-3865719 AATCATAAGAAGGAACACAATGG + Intergenic
1003310646 6:4966969-4966991 AAATAAAAGCAGGAAGGAAAGGG + Intergenic
1004038146 6:11944829-11944851 AATTGTTAGCAGTAAAGGAAAGG - Intergenic
1004078255 6:12365373-12365395 ACTGTTAAGTAGGAACGGAATGG + Intergenic
1005631138 6:27709204-27709226 ACTTATAAGTAGCAAGGGAAAGG - Intergenic
1008815789 6:55564001-55564023 AATGCTAAGCAGAAATGGAAAGG + Intronic
1009752257 6:67888198-67888220 AATTAGAAGCAGGTTCGGATAGG + Intergenic
1009964744 6:70566700-70566722 ACTGACAAGCATGAACGGAACGG + Intergenic
1010480423 6:76345567-76345589 AAGTATAAGCAAGAACGTCATGG + Intergenic
1012539111 6:100339880-100339902 AATTCTTAGCAGAAACTGAAGGG + Intergenic
1014768108 6:125430503-125430525 AATTATGATCAAGAAAGGAAAGG - Intergenic
1015215067 6:130740730-130740752 AATTATAAACAGGAAAAAAAGGG - Intergenic
1016814957 6:148294726-148294748 AATCATAAGGAGGAACGAGAGGG + Intronic
1017559590 6:155613055-155613077 GATTATAAGAAGGCATGGAAAGG - Intergenic
1017980669 6:159398496-159398518 AAATAAAAGCAGGCACAGAAGGG + Intergenic
1018512286 6:164537964-164537986 AATTAGAAACAGGAAGAGAAAGG - Intergenic
1018576378 6:165264306-165264328 CATGAGAAGCAGGAAAGGAAGGG - Intergenic
1020697012 7:11424935-11424957 AATAATAAGCAGTAAAGGAGGGG - Intronic
1020871822 7:13640234-13640256 TAATAGAAGCAGGAACGCAAAGG - Intergenic
1021466794 7:20953079-20953101 AAGGATAACCAGGAAGGGAAGGG + Intergenic
1021741558 7:23691092-23691114 AATTATAAGCAGGCATGGCGGGG - Intronic
1021968377 7:25944482-25944504 AATTAAAAGCAGGAGGGAAAAGG + Intergenic
1022821722 7:33968808-33968830 AATTAAAAGCAGGAAAATAAAGG - Intronic
1025736952 7:64159071-64159093 AATTATAAGCCTGGAGGGAATGG - Intronic
1027775275 7:82457417-82457439 AATTATAAGCATTAACGCTATGG + Intergenic
1029006809 7:97219529-97219551 ATTTTTAAGGAGGAAGGGAATGG - Intergenic
1030841860 7:114363789-114363811 AAATATCAGCAGCAAAGGAAGGG - Intronic
1031272083 7:119664583-119664605 AATTTTAAGAAGGAATGGCAAGG + Intergenic
1032308858 7:130763239-130763261 AATTCTACGCAGGAATGAAAAGG - Intergenic
1036763403 8:11528877-11528899 AATTATAAGTGGGAGCTGAACGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040565512 8:48563600-48563622 AGTTATAAAAAGGAACCGAATGG - Intergenic
1041957251 8:63569791-63569813 AATTATCTGGAGGAAGGGAATGG - Intergenic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1046170094 8:110494381-110494403 AAATCTAAGCAGGAACCCAAAGG + Intergenic
1048566186 8:135600219-135600241 GATTTTAAGCAGGGAGGGAAGGG + Intronic
1048638624 8:136327630-136327652 GATTTTAAGCAGGAATTGAATGG + Intergenic
1048957829 8:139551351-139551373 AATTATAAGGAAGAAAGGGAGGG + Intergenic
1049891816 9:76503-76525 AAGTATAAGCATGAATAGAAAGG - Intergenic
1052095938 9:24384170-24384192 ACTTATAACCAGGAAGGTAAGGG - Intergenic
1053733240 9:41077594-41077616 AAGTATAAGCATGAATAGAAAGG - Intergenic
1058905260 9:109477654-109477676 AATTATTAGCAGCAGCGGGAGGG + Intronic
1060326256 9:122618944-122618966 AATTATAAAAAGGAACCAAATGG + Intergenic
1203794370 EBV:168825-168847 AATTATAAGCATGAGAGCAAAGG + Intergenic
1187346336 X:18468181-18468203 AATTATAATCAGCAAATGAATGG + Intronic
1188957944 X:36455858-36455880 ACTTATAAGCAGGAAGAGATGGG + Intergenic
1190098545 X:47502583-47502605 AATGATGAGGAGGAAAGGAATGG + Intergenic
1191896709 X:66000505-66000527 AAGTAGAAGAAGGAAAGGAAAGG + Intergenic
1194160555 X:90444730-90444752 ATTTAAAAACAGGAAAGGAAGGG - Intergenic
1194464359 X:94213903-94213925 AATTAAAAGAAGAAAAGGAAAGG + Intergenic
1196562878 X:117172335-117172357 TATTATAAGCAGCAAATGAAAGG + Intergenic
1198752454 X:139949308-139949330 AATTAGAAGCAACAAAGGAAGGG - Intergenic
1199098844 X:143774376-143774398 AATTTGAAGCAGGAACAGGAAGG + Intergenic
1202266842 Y:23028520-23028542 AATTGGAAGCAGGAAGAGAATGG - Intergenic
1202419835 Y:24662265-24662287 AATTGGAAGCAGGAAGAGAATGG - Intergenic
1202450951 Y:25007819-25007841 AATTGGAAGCAGGAAGAGAATGG + Intergenic