ID: 998344651

View in Genome Browser
Species Human (GRCh38)
Location 5:141451113-141451135
Sequence AATCATAAGGCTGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7949
Summary {0: 1, 1: 14, 2: 179, 3: 1377, 4: 6378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998344651_998344656 2 Left 998344651 5:141451113-141451135 CCACCACACCCAGCCTTATGATT 0: 1
1: 14
2: 179
3: 1377
4: 6378
Right 998344656 5:141451138-141451160 ATTTAGACTAGACATTTTTTTGG 0: 1
1: 0
2: 3
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998344651 Original CRISPR AATCATAAGGCTGGGTGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr