ID: 998345011

View in Genome Browser
Species Human (GRCh38)
Location 5:141454694-141454716
Sequence TGGAATAAGCAGGTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998345011_998345016 4 Left 998345011 5:141454694-141454716 CCATGCTCCACCTGCTTATTCCA 0: 1
1: 0
2: 3
3: 19
4: 272
Right 998345016 5:141454721-141454743 ATATGTTATAGGATGAAAAGAGG 0: 1
1: 0
2: 0
3: 26
4: 306
998345011_998345014 -7 Left 998345011 5:141454694-141454716 CCATGCTCCACCTGCTTATTCCA 0: 1
1: 0
2: 3
3: 19
4: 272
Right 998345014 5:141454710-141454732 TATTCCATATTATATGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998345011 Original CRISPR TGGAATAAGCAGGTGGAGCA TGG (reversed) Intronic
901913680 1:12481165-12481187 TGGGAAAAGCAGGTGCAGCCAGG - Intronic
902845479 1:19106968-19106990 TGGAGGAGGCAAGTGGAGCAAGG + Intronic
903009617 1:20320449-20320471 TGGGATAAGAAGCTGGAGCCCGG + Intronic
903321188 1:22544101-22544123 AGGTATTAGGAGGTGGAGCAGGG + Intergenic
904614440 1:31742375-31742397 TGGAGTGAGCAGGTGGTGCCTGG + Intronic
904883322 1:33716996-33717018 AGGAAGAGGCAGGTGGAGGATGG + Intronic
905260833 1:36717154-36717176 TGGCATCGGCAGGTGGAGCAAGG + Intergenic
906055416 1:42912370-42912392 TGGAATAAAAAGGTAGAGGAGGG - Intergenic
906712856 1:47944544-47944566 TGAAAAGAGCAGGTGGAGGAAGG + Intronic
907564074 1:55418245-55418267 TGTATTAATCAGGTGGAGCGTGG + Intergenic
908213518 1:61926206-61926228 TGGCAAAGGCAGCTGGAGCAAGG - Intronic
908656450 1:66393980-66394002 GGGAATATGCAGCTGGGGCAGGG - Intergenic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
912083085 1:105962626-105962648 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
916348902 1:163826602-163826624 TGAGATAGGCAGGTGCAGCAAGG - Intergenic
918443659 1:184594709-184594731 TGGAAACAGCAGGTGCAGGAGGG - Intronic
918693196 1:187508463-187508485 TAGAAGAAGAAGGTAGAGCAAGG + Intergenic
919040965 1:192387895-192387917 TGGAACAAAAAGGTGGAGAAAGG - Intergenic
919762947 1:201109971-201109993 TGGAATAAGCAGGTTGACCCTGG + Intronic
920298046 1:204971517-204971539 TGGTAGAAGCAGGTGGAGAGGGG + Intronic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
920658078 1:207891185-207891207 TGCACTCAGCAGGTGGAGGAAGG - Intronic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
923450360 1:234111658-234111680 TGGAGTCAGCAGAGGGAGCATGG - Intronic
924887242 1:248231726-248231748 TGTAATAATCAGGTTGAGGAAGG - Intergenic
1062973101 10:1663423-1663445 AGGGATGAGCAGGCGGAGCACGG - Intronic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1065565417 10:27002614-27002636 TGGGATAAGCAGGTTAAGAAAGG + Intronic
1066554210 10:36593375-36593397 ATGAATAAGCAGGTCGATCAAGG - Intergenic
1067256590 10:44647837-44647859 TGGACTTAGCAGAGGGAGCAAGG + Intergenic
1067901659 10:50247987-50248009 TGGAGTGAGGAGGTGGACCAAGG - Intronic
1068400779 10:56525327-56525349 TGCAAGAAGCTGGTAGAGCAGGG + Intergenic
1068543385 10:58320896-58320918 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1069646510 10:70002498-70002520 TGGAATAAGTAGTTTTAGCAGGG - Intergenic
1070439964 10:76433478-76433500 TTGGACAGGCAGGTGGAGCACGG + Intronic
1071597339 10:86937895-86937917 AGGAAAGAGCAGGTGGAGCCAGG + Intronic
1072171288 10:92864659-92864681 TGGAATAAAAAGGTGAAGGAAGG + Intronic
1072278084 10:93842218-93842240 AGGAAGAAGCAGGTGAGGCAGGG - Intergenic
1073427254 10:103462822-103462844 AGGAGTGAGCAGGTGGAGCCGGG - Intergenic
1073581996 10:104677096-104677118 CAGAATAAGCGGGTTGAGCAAGG + Intronic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1073946117 10:108752650-108752672 TGGAAGGCGAAGGTGGAGCAAGG + Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074371612 10:112905091-112905113 AGGAATAAACAGGTGGTTCAGGG + Intergenic
1074975110 10:118573782-118573804 TCTAATAAGCATGTTGAGCATGG + Intergenic
1075315661 10:121451142-121451164 AGGGATGAGTAGGTGGAGCATGG - Intergenic
1077377890 11:2214064-2214086 AGGAACAAACAGGTGGAGCATGG - Intergenic
1079073374 11:17367576-17367598 TGTAGTCATCAGGTGGAGCAGGG + Intronic
1079498312 11:21071707-21071729 TGGAAGCAGCAGGTGGTTCATGG + Intronic
1079924320 11:26473996-26474018 TGGAAAAAGCAGGCGGTGAAAGG + Intronic
1082877952 11:58007289-58007311 TTGAATATGGAGGTGGAGTAGGG + Intergenic
1083796537 11:65020152-65020174 TGGAAGAGGAAGCTGGAGCATGG + Intronic
1083901131 11:65644104-65644126 TGGTTTAAGGAGGAGGAGCAGGG + Intronic
1084215158 11:67643053-67643075 TGGATTAAGGAAGTGAAGCATGG - Intronic
1084863747 11:72039627-72039649 TGGAACTATCAGGTGGAGAAGGG - Intronic
1086269286 11:85041038-85041060 GGGAATAGGCAGGGGGAACAGGG + Intronic
1086276699 11:85138520-85138542 GGGTATAAGAAGGTGGAGTATGG - Intronic
1087475909 11:98634318-98634340 TGGAAGAGGCAGTTAGAGCAAGG - Intergenic
1087759932 11:102094614-102094636 TGGAATAAGCAGGCTGAACTTGG + Intergenic
1088445307 11:109920519-109920541 AGTAATAAGCAGCTAGAGCAAGG - Intergenic
1088902614 11:114129505-114129527 GGGAATAGGCAGGTGGGCCAAGG - Intronic
1089407659 11:118211829-118211851 TGGGATTAGCAGATGCAGCATGG - Intronic
1089760777 11:120721556-120721578 GGGAAGAACCAGGTGAAGCAAGG + Intronic
1090013207 11:123062739-123062761 TGGAACACGAAGGTGGGGCATGG - Intronic
1090484528 11:127101024-127101046 TGCAATAAGCAGGATGAGCCTGG - Intergenic
1090775045 11:129957236-129957258 TGCAATAAGGAGTTAGAGCATGG - Intronic
1091033768 11:132214794-132214816 TGGAAACAGAAGATGGAGCAAGG + Intronic
1091344978 11:134846307-134846329 TGGGATAGGCATGTGGAGCTGGG - Intergenic
1093013206 12:14129822-14129844 TGGGATAAGCAGCCGGAGCAGGG - Intergenic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093499926 12:19799939-19799961 TGGATTAATGAGGTGGAGAAAGG - Intergenic
1093647949 12:21610468-21610490 TGAAATAATCAGCTGGAGCTGGG + Intergenic
1093928239 12:24929975-24929997 TGGAAACAGCAGCTGGAGAATGG - Intronic
1096933335 12:55241307-55241329 TAGAATTTGGAGGTGGAGCAGGG + Intergenic
1097456771 12:59808322-59808344 AGGAATTTGCAGGAGGAGCAGGG - Intergenic
1098617864 12:72552624-72552646 TGGAGTAACAAGGTGGAGAAGGG + Intronic
1099558095 12:84136398-84136420 TAGAATAAGAAAGTGGAGAAAGG - Intergenic
1099821702 12:87719611-87719633 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1101107603 12:101455624-101455646 TGGAATAAGCAGATTGGGAAAGG - Intergenic
1102047079 12:109835991-109836013 TGGGCTAAGCAGCTGGAGCTTGG + Intergenic
1103335050 12:120183080-120183102 TGGAAGGAGCAGGTAGAGAATGG + Intronic
1105289712 13:19044645-19044667 AGGGATGAGCAGGTGGAGCACGG + Intergenic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1105580342 13:21689890-21689912 TGGAAGAAGCAGGAAGAGCTTGG - Intronic
1105803650 13:23935709-23935731 TGGAATAAGCATGTTGGACAAGG - Intergenic
1106653701 13:31719535-31719557 TGGAATAAAAAGGTAGAGGAAGG - Intergenic
1106677638 13:31978036-31978058 TGGAAAACACAGGTGGAACATGG - Intergenic
1107450196 13:40501321-40501343 TGGACTAAGCAGGTCTGGCATGG - Intergenic
1107739260 13:43432007-43432029 TGGAATAAACAGGCGTAGGATGG - Intronic
1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG + Intergenic
1113792426 13:113036002-113036024 TGGCCTCAGCAGGTGGAGGATGG + Intronic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114886832 14:26863117-26863139 GGGAACAAGGAGGTGGACCATGG - Intergenic
1115151022 14:30285906-30285928 TGCAATAAGTGGGTGGAGCCAGG + Intergenic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116050198 14:39793384-39793406 TAGAATAATCAGGAGGAGAACGG - Intergenic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1116438036 14:44915839-44915861 TGGCATTAGGAGGTGGGGCAAGG + Intergenic
1117764370 14:59065011-59065033 TTAATTCAGCAGGTGGAGCAAGG - Intergenic
1118002030 14:61532143-61532165 TGGACTAAATATGTGGAGCATGG - Intronic
1119350922 14:73964889-73964911 TGGAATAAGCTGTTTGAACATGG + Exonic
1121413373 14:93762792-93762814 TGGAAGAAGCAGATGGAGTGGGG - Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1125652944 15:41332425-41332447 TGGGATACGCAGGTGGTGAAGGG - Exonic
1128495442 15:68195888-68195910 TGGAGTCAGCAGAGGGAGCAGGG - Intronic
1129087015 15:73104786-73104808 TGGAAGGTGAAGGTGGAGCAGGG + Intronic
1129913542 15:79247756-79247778 TGGAATAAGAAGATGGGGCAGGG + Intergenic
1130041543 15:80409216-80409238 AGGAATGAATAGGTGGAGCATGG - Intronic
1130788679 15:87128155-87128177 TGGAATAAGTATGGAGAGCAGGG - Intergenic
1131181174 15:90241107-90241129 TGGAAGCAGCGGGTGGAGCTGGG + Exonic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132885249 16:2179534-2179556 CCGAGTAAGGAGGTGGAGCAGGG + Intronic
1135379056 16:21978509-21978531 TGGAAAAGGCAGGTGGGGAAGGG - Intronic
1135380509 16:21992538-21992560 TAGAAAAAGCAGGTGGAAAAAGG + Intronic
1137816775 16:51405524-51405546 TGGAAAAAGGAGGTTGAACAGGG - Intergenic
1138923858 16:61566959-61566981 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1139361723 16:66403682-66403704 TGGAGTATGGAGTTGGAGCAGGG - Exonic
1140736489 16:77902663-77902685 TGGAATAAAAAGGCCGAGCATGG + Intronic
1140869866 16:79096464-79096486 TGGGATAACCAGGAGGGGCATGG - Intronic
1141696961 16:85624727-85624749 TGGAATAAACAGGTGGAGAGAGG + Intronic
1143714339 17:8756257-8756279 TGGAATCAGCAGGTGGGAGATGG + Intronic
1143980484 17:10865238-10865260 TGGCACAAGTAGGTGGAGAAGGG - Intergenic
1144363848 17:14522959-14522981 TGGATTAGGGAGGTGGAGTATGG - Intergenic
1144645932 17:16973358-16973380 TGCAGGAAGCAGCTGGAGCAGGG + Intergenic
1144713170 17:17416221-17416243 TGAAAGAAGAAGGTGGCGCAAGG - Intergenic
1145303500 17:21656698-21656720 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1145346544 17:22045151-22045173 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1145879708 17:28344332-28344354 GGGAGGAAGAAGGTGGAGCAAGG - Intronic
1146438571 17:32874017-32874039 TGGATTAAGCAGCATGAGCAGGG - Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1149353773 17:55818328-55818350 TGGAATAGCCAGGAGGAGCTAGG - Intronic
1151654649 17:75490250-75490272 TGGAAAGAGCAGGGGGAGGATGG - Exonic
1152775825 17:82201414-82201436 TGGAATCAGCAGCGGGAGGAGGG + Intronic
1153874588 18:9357816-9357838 TGCCATAAGGAGGAGGAGCAGGG + Intronic
1156656868 18:39298696-39298718 GGGAAGACGCAGGAGGAGCAAGG - Intergenic
1156665916 18:39406778-39406800 TGGAATAAACAGGTCAAGGAAGG - Intergenic
1157931338 18:51826775-51826797 TGAAAAAAACAGGTTGAGCAGGG - Intergenic
1158001214 18:52621451-52621473 TGGAATAAGGCAGTGGAGAAAGG - Intronic
1158661892 18:59396024-59396046 AGGAATCTGCAGGTGGGGCAGGG - Intergenic
1158879948 18:61768511-61768533 TGGAAGATGAAGGAGGAGCAAGG - Intergenic
1158893276 18:61893007-61893029 TGCACTAGGGAGGTGGAGCAAGG + Exonic
1159349784 18:67257934-67257956 TGGAATTAGCAGTTGGGGCCGGG - Intergenic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1164751649 19:30659743-30659765 TGTAATAATCTGGTGGAGCCAGG - Intronic
1166234856 19:41448105-41448127 TGTTTTGAGCAGGTGGAGCAGGG + Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
925032276 2:660187-660209 GGGAGGGAGCAGGTGGAGCAGGG + Intergenic
925513880 2:4658148-4658170 TGGAAACAGCAGGAGCAGCAGGG - Intergenic
927036183 2:19179067-19179089 TAGAATGAGCAGGTGGAGCAAGG - Intergenic
928574512 2:32641556-32641578 TGCAACAATCAGATGGAGCAGGG - Intronic
928604351 2:32931585-32931607 TGGAATTATCACGTAGAGCAAGG - Intergenic
933010943 2:77062743-77062765 AGGAATAAGCAGGTGGCTTATGG + Intronic
934726741 2:96625964-96625986 TTGAATAGGCGGGTGGGGCACGG - Intronic
935823765 2:106920890-106920912 AGGAATAAATGGGTGGAGCATGG - Intergenic
936475736 2:112838078-112838100 TGGAGGAACCAGGAGGAGCAAGG - Intergenic
936861632 2:117027072-117027094 TGTAATAAGCAGGAGGAACAGGG - Intergenic
937216654 2:120317447-120317469 TGGAAGCAGCAGGTGGAGGTGGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
939655620 2:144820381-144820403 TGGAAGCATCAGATGGAGCAGGG + Intergenic
940063541 2:149599887-149599909 TGGAATAAAAGGGTGGAGAAAGG - Intergenic
941086189 2:161121155-161121177 TGGAATGATGAGGGGGAGCATGG - Intergenic
946063723 2:216968245-216968267 TGGAGGAAGCAGGTGCTGCAGGG + Intergenic
948546333 2:238731757-238731779 CGGAATGGGCAGGTGGAGAATGG + Intergenic
1168804769 20:665870-665892 TGAAGTGAGCAGGTGGAGGAGGG + Intronic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1170568673 20:17620901-17620923 TGAAGTCAGCAGGCGGAGCACGG - Intronic
1171521020 20:25774381-25774403 TGGGCTGAGCAGGTGGAGTAGGG - Exonic
1171555905 20:26082095-26082117 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1172872943 20:38147098-38147120 GGGAAGAAGGAGGTGGGGCAGGG + Intronic
1173941089 20:46912086-46912108 TGCAAATAGAAGGTGGAGCATGG + Intronic
1174288809 20:49492210-49492232 TGAAATAAGCAGGTACAGAAAGG + Intergenic
1174485178 20:50856472-50856494 TGGAGTGAGAAGCTGGAGCAGGG + Intronic
1174741610 20:53019989-53020011 TGGAAGATGCAGGGGAAGCAAGG + Intronic
1175213560 20:57377237-57377259 TGGAAGAGGGAGGTGGGGCATGG - Intronic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1177910935 21:27031056-27031078 TGGAATAAGCAGGTTGAAAAAGG - Intergenic
1178979041 21:37245441-37245463 AAGAACAAGCAGGTGGAGCAAGG - Intronic
1179031732 21:37726418-37726440 TGGAAAAAGCACGTGGTACATGG + Intronic
1184262182 22:43324747-43324769 AGAAACAGGCAGGTGGAGCAGGG + Intronic
1184369890 22:44075581-44075603 AGGGATGAGCAGGTGGGGCACGG - Intronic
1184459652 22:44629875-44629897 AGGGATAAGCAGGTAGGGCATGG + Intergenic
1184908223 22:47506792-47506814 AGGACAAAGCAGGTGGAGGACGG + Intergenic
1185117369 22:48945407-48945429 AGGTCTGAGCAGGTGGAGCAGGG + Intergenic
949868629 3:8568266-8568288 TGGAATAGGCAGGTGGGGCGGGG - Intergenic
950520492 3:13495113-13495135 TGGAAGGAGCAGGTGGAGGGAGG - Intronic
951973840 3:28480759-28480781 TGGTATAAGGAAGTGGGGCAGGG + Intronic
952019641 3:29002111-29002133 TGGAATTACCAAGTGGCGCAAGG - Intergenic
952543743 3:34396219-34396241 TGCACTAAGCAGATGCAGCATGG - Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
952918885 3:38270975-38270997 TGGGATTAGCATGTGGTGCAGGG - Intronic
953246865 3:41200450-41200472 TGAAATAAGGGGGTGGAGGAAGG + Intronic
960184240 3:114618886-114618908 TGCAATTAGCAGGAGGTGCAAGG + Intronic
964434922 3:156641378-156641400 TGGATCAAGCAAGTGGAGGATGG - Intergenic
965621221 3:170644060-170644082 TGCATTAAGCAGGTGGAAGAAGG + Intronic
967959449 3:194908729-194908751 TGTTATTAGGAGGTGGAGCATGG - Intergenic
968893966 4:3388114-3388136 TGGGAAAAGAAGGAGGAGCAGGG - Intronic
969274955 4:6128689-6128711 AGGACTTGGCAGGTGGAGCATGG - Intronic
974578842 4:63767741-63767763 TGAGATAAGGAGGTGGAGGATGG - Intergenic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
978170126 4:105659638-105659660 TGCATCAGGCAGGTGGAGCAAGG - Intronic
979935899 4:126695130-126695152 TGGAAGAAGCAGGTAATGCAGGG - Intergenic
980792145 4:137633432-137633454 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG + Intergenic
982176806 4:152713341-152713363 TAAAATAAGCAGGTGCAGAAGGG + Intronic
984070704 4:175108579-175108601 TGAAAGAAACAGGTGAAGCAGGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987379748 5:17274553-17274575 TGGAACAGGCATGTGCAGCATGG - Intronic
987989581 5:25193188-25193210 TAGAACAAGCAGGTGGAGAGAGG + Intergenic
988625648 5:32871668-32871690 TGGAATGAGCTGGTGGGCCAGGG + Intergenic
988705428 5:33721758-33721780 AGGAAGAAGCAGGTGGTGAAGGG - Intronic
992948074 5:81829214-81829236 TAGAAAAAGCAGGTGGATGAAGG + Intergenic
995190030 5:109310136-109310158 TGGAAGACACAGGTGAAGCATGG + Intergenic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
998033015 5:138889551-138889573 TGGAAAAAGCTCCTGGAGCAAGG - Intronic
998345011 5:141454694-141454716 TGGAATAAGCAGGTGGAGCATGG - Intronic
1000280819 5:159780456-159780478 TGGAATAACCAGGATGATCAAGG - Intergenic
1000361766 5:160454159-160454181 TTCAATAGGCAGGGGGAGCAGGG - Intergenic
1002965387 6:1960968-1960990 TGGAAAAAGCAGGCGGAGACAGG + Intronic
1002975554 6:2071825-2071847 TGGCATAAGCAGCTCGAGCTTGG - Intronic
1003013692 6:2450789-2450811 TAGCACAAGCAGGTGGGGCATGG + Intergenic
1003015237 6:2462676-2462698 TGGAAGAGGCAGATGGAGAAGGG - Intergenic
1004107614 6:12680357-12680379 TGCAATAAGCAGGTGGAGCTGGG - Intergenic
1005896807 6:30185769-30185791 TGGCCTAAGCACCTGGAGCAGGG - Exonic
1006743617 6:36326173-36326195 TGCAAGAAGGAGCTGGAGCAGGG - Intronic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1007381729 6:41494607-41494629 TGGAATAAGCAGGGAGAGACAGG - Intergenic
1008887003 6:56442329-56442351 TGGAAGATGCAGGTGAAGCCTGG + Intergenic
1009431931 6:63573647-63573669 TCGAATTACCAGGTGGAGCCTGG - Intronic
1014042846 6:116849879-116849901 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1015621071 6:135132259-135132281 TGGAAGCAGCAGGGGAAGCAAGG + Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1021225822 7:18025099-18025121 AAGAAAAAGAAGGTGGAGCAGGG - Intergenic
1021506207 7:21388373-21388395 AGGAATGAATAGGTGGAGCATGG - Intergenic
1021816597 7:24453068-24453090 TGGAATAAGCAGGTTGGAAAAGG + Intergenic
1022484474 7:30767715-30767737 TGGAATAAGCAGGTAAAGATTGG - Intronic
1022521004 7:31006816-31006838 TTGAATCAGCAGGTAGAGAAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1025157379 7:56620569-56620591 TGGGAAAAGGAGGTGGAGCCAGG + Intergenic
1025281496 7:57629331-57629353 TGGGCTGAGCAGGTGGAGTAGGG - Intergenic
1025303234 7:57836184-57836206 TGGGCTGAGCAGGTGGAGTAGGG + Intergenic
1026341630 7:69439178-69439200 TGGAATAAGGCTGGGGAGCAAGG - Intergenic
1026589863 7:71685247-71685269 TGGCAGAAGCAGGTGGTTCAGGG + Intronic
1029333528 7:99880309-99880331 TGGAGTGATCAGGAGGAGCATGG - Intronic
1029478555 7:100799654-100799676 TGGAAAAAGCAGGTCGGGCGTGG + Intergenic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1033048215 7:137981250-137981272 GAGAATAGGAAGGTGGAGCATGG + Intronic
1033801503 7:144907497-144907519 TGGATTATGCATGTGGAGGAAGG - Intergenic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1034629638 7:152521186-152521208 AGGAATAAGCAGGAGGAGCTTGG - Intergenic
1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG + Intronic
1035415989 7:158686973-158686995 TGGAATCTGCAGGAGCAGCAGGG - Intronic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1036617935 8:10403370-10403392 TGGCATGAGCATGTGGAGCTAGG - Intronic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1038569135 8:28644732-28644754 TGAAATAATCAGTTGAAGCAAGG - Intronic
1039382932 8:37102809-37102831 TGGAGGAAACAGGAGGAGCATGG - Intergenic
1043797717 8:84566309-84566331 TGGAAAAAGTTGGTGGGGCAGGG + Intronic
1047573691 8:126130220-126130242 TGGAAGGAGAAGGTGAAGCAAGG - Intergenic
1047740552 8:127803033-127803055 TGGAAAAGGCAGGTGGGGCGAGG + Intergenic
1048155106 8:131939963-131939985 GGGAAAAAGAAGGTAGAGCAGGG + Intronic
1048847928 8:138617251-138617273 TGGAACAATCAGGAGGAACAAGG - Intronic
1048921865 8:139238668-139238690 TAGAATAAGAAGGTGGAGAATGG + Intergenic
1050991122 9:12153541-12153563 TGCAATTAGTAAGTGGAGCAGGG - Intergenic
1051810970 9:21049151-21049173 TGGAATAAAAAGGTGGAGGAAGG - Intergenic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1052573704 9:30264401-30264423 TGGAATAAACAGTGGTAGCAAGG - Intergenic
1055660601 9:78500116-78500138 TGGAATGACCATGTGGAGGAGGG + Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1058096177 9:100862716-100862738 TAGAAAAAGCAGGTGGAAGACGG + Intergenic
1060316625 9:122517303-122517325 TGGAGTGAGCAGGTGCAGCCGGG + Intergenic
1061588797 9:131584859-131584881 TCGAATCTGCAGGTGGAGCATGG + Intronic
1062648090 9:137560349-137560371 AGGAAAAAACAGGTGGGGCAAGG + Intronic
1203491488 Un_GL000224v1:109744-109766 TGTAATAAACAGGAAGAGCAGGG - Intergenic
1203504112 Un_KI270741v1:51615-51637 TGTAATAAACAGGAAGAGCAGGG - Intergenic
1187911233 X:24113023-24113045 AGGGATAAGTAGGTGGAACATGG - Intergenic
1190318355 X:49165278-49165300 ACGAATAACCAGGTGGAGCTGGG - Exonic
1191604675 X:63047982-63048004 TCAAATAAACAGGTGGAGAAAGG - Intergenic
1191667304 X:63716638-63716660 TTCAATAAGCAGGTAAAGCATGG - Intronic
1192926530 X:75759949-75759971 TGGAATATGCAGGCTGTGCAGGG - Intergenic
1193336309 X:80294152-80294174 TGAAATAAGCAGGTGGATAGAGG + Intergenic
1197633269 X:128886599-128886621 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1197865103 X:131009190-131009212 TGGAAGATGAAGGGGGAGCAAGG - Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1198644315 X:138789574-138789596 TGGAAGAAGCTGGTGGTGAAGGG - Intronic
1199988312 X:152968511-152968533 TGAAAGAAGCAGGAGGAGCAGGG + Intronic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic
1202138716 Y:21698287-21698309 TGGGATATGCAGGTGGATTAGGG - Intergenic