ID: 998352651

View in Genome Browser
Species Human (GRCh38)
Location 5:141511508-141511530
Sequence GAGGGAGGCATGGGATGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 581}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998352651_998352672 27 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352672 5:141511558-141511580 TTTCCCGAGTAAGGTGGTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 82
998352651_998352670 25 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352670 5:141511556-141511578 TCTTTCCCGAGTAAGGTGGTTGG 0: 1
1: 0
2: 0
3: 1
4: 69
998352651_998352668 21 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352651_998352671 26 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352671 5:141511557-141511579 CTTTCCCGAGTAAGGTGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 88
998352651_998352667 18 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352667 5:141511549-141511571 CAGTTCCTCTTTCCCGAGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998352651 Original CRISPR GAGGGAGGCATGGGATGGAT GGG (reversed) Exonic