ID: 998352668

View in Genome Browser
Species Human (GRCh38)
Location 5:141511552-141511574
Sequence TTCCTCTTTCCCGAGTAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998352657_998352668 3 Left 998352657 5:141511526-141511548 CCCTCCTCCCCACCCCACTCCAA 0: 1
1: 3
2: 29
3: 315
4: 2254
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352659_998352668 -1 Left 998352659 5:141511530-141511552 CCTCCCCACCCCACTCCAACAGT 0: 1
1: 0
2: 8
3: 108
4: 985
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352662_998352668 -6 Left 998352662 5:141511535-141511557 CCACCCCACTCCAACAGTTCCTC 0: 1
1: 0
2: 1
3: 37
4: 388
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352658_998352668 2 Left 998352658 5:141511527-141511549 CCTCCTCCCCACCCCACTCCAAC 0: 1
1: 3
2: 46
3: 397
4: 2619
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352655_998352668 11 Left 998352655 5:141511518-141511540 CCATGCCTCCCTCCTCCCCACCC 0: 3
1: 5
2: 103
3: 1245
4: 11472
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352660_998352668 -4 Left 998352660 5:141511533-141511555 CCCCACCCCACTCCAACAGTTCC 0: 1
1: 1
2: 5
3: 73
4: 605
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352651_998352668 21 Left 998352651 5:141511508-141511530 CCCATCCATCCCATGCCTCCCTC 0: 1
1: 0
2: 7
3: 59
4: 581
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352656_998352668 6 Left 998352656 5:141511523-141511545 CCTCCCTCCTCCCCACCCCACTC 0: 1
1: 5
2: 79
3: 1008
4: 7406
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352664_998352668 -10 Left 998352664 5:141511539-141511561 CCCACTCCAACAGTTCCTCTTTC 0: 1
1: 0
2: 4
3: 41
4: 330
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352654_998352668 12 Left 998352654 5:141511517-141511539 CCCATGCCTCCCTCCTCCCCACC 0: 1
1: 2
2: 31
3: 234
4: 1955
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352663_998352668 -9 Left 998352663 5:141511538-141511560 CCCCACTCCAACAGTTCCTCTTT 0: 1
1: 0
2: 3
3: 16
4: 309
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352653_998352668 16 Left 998352653 5:141511513-141511535 CCATCCCATGCCTCCCTCCTCCC 0: 1
1: 0
2: 34
3: 381
4: 3481
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352661_998352668 -5 Left 998352661 5:141511534-141511556 CCCACCCCACTCCAACAGTTCCT 0: 1
1: 1
2: 5
3: 41
4: 357
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110
998352652_998352668 20 Left 998352652 5:141511509-141511531 CCATCCATCCCATGCCTCCCTCC 0: 1
1: 1
2: 30
3: 462
4: 2448
Right 998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998352668 Original CRISPR TTCCTCTTTCCCGAGTAAGG TGG Exonic