ID: 998354427

View in Genome Browser
Species Human (GRCh38)
Location 5:141523012-141523034
Sequence CCTATGTAAACTCAGTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998354427_998354429 -7 Left 998354427 5:141523012-141523034 CCAGAATACTGAGTTTACATAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 998354429 5:141523028-141523050 ACATAGGCTAGCATGCTCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 70
998354427_998354438 26 Left 998354427 5:141523012-141523034 CCAGAATACTGAGTTTACATAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 998354438 5:141523061-141523083 CAGGCTGTGGCAGGTACTACAGG No data
998354427_998354433 17 Left 998354427 5:141523012-141523034 CCAGAATACTGAGTTTACATAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 998354433 5:141523052-141523074 CCCCCTTTCCAGGCTGTGGCAGG 0: 1
1: 0
2: 2
3: 32
4: 329
998354427_998354431 13 Left 998354427 5:141523012-141523034 CCAGAATACTGAGTTTACATAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 998354431 5:141523048-141523070 AGGTCCCCCTTTCCAGGCTGTGG 0: 1
1: 0
2: 3
3: 21
4: 244
998354427_998354430 7 Left 998354427 5:141523012-141523034 CCAGAATACTGAGTTTACATAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 998354430 5:141523042-141523064 GCTCTAAGGTCCCCCTTTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998354427 Original CRISPR CCTATGTAAACTCAGTATTC TGG (reversed) Intronic
900433929 1:2617908-2617930 CCTGTGTCAACTGAGTATTCAGG - Intronic
901053792 1:6439407-6439429 CCTCTGGGAACTCAGTCTTCTGG + Intronic
906786393 1:48619714-48619736 CCTATGCAGACTCAGCAGTCGGG - Intronic
907061176 1:51427132-51427154 ACTATGTAAACTGGGTATGCTGG - Intronic
908126349 1:61034371-61034393 CCTATTTTAACTTTGTATTCAGG + Intronic
909047351 1:70726971-70726993 CCTCTCTAAACTGACTATTCTGG + Intergenic
909696302 1:78471618-78471640 CCAATGGAAAGTCAGTCTTCTGG - Intronic
911580190 1:99625141-99625163 CATCCGTAAACTCAGTATTCTGG - Intergenic
911584752 1:99678226-99678248 CCTATATAATCCCAGTACTCGGG - Intronic
913244371 1:116858892-116858914 ACTATGTTTACTCAGTACTCAGG + Intergenic
914962823 1:152221140-152221162 TCTTTGAAAACTCAGTCTTCTGG + Exonic
920006637 1:202838050-202838072 CCTATCAAAACTCAAAATTCTGG + Intergenic
921567614 1:216739025-216739047 CCAAGGTAAACTAAGTATTAAGG - Intronic
922971150 1:229740091-229740113 TCTATAAAAACTCTGTATTCTGG + Intergenic
1062761930 10:29034-29056 CCTCTCTAAACTGAATATTCTGG - Intergenic
1066101043 10:32118951-32118973 TCTATTTAAACTTAGTCTTCTGG + Intergenic
1066567768 10:36738190-36738212 CCCATGTAATCTCAGCATTTCGG - Intergenic
1067923339 10:50481802-50481824 CCTCTCTAAACTGATTATTCTGG - Intronic
1068878269 10:62021133-62021155 TCTATGTAAATGCAGTCTTCAGG - Intronic
1069866709 10:71508297-71508319 AATATGTAAACTCAAGATTCAGG - Intronic
1072007857 10:91272510-91272532 CCTCTGTAATCTCAGCATTTTGG + Intronic
1072028347 10:91488858-91488880 CCTGTTTAAACTCATTCTTCAGG - Intronic
1072088049 10:92099901-92099923 CCTATATAATCTCAGCATTTTGG + Intronic
1075281964 10:121146895-121146917 CCTCTGTAAACTTGTTATTCTGG + Intergenic
1075544719 10:123346402-123346424 CCTTTGTAATCTCAGTAATAGGG + Intergenic
1075693484 10:124417543-124417565 CCTGTGTAATCCCAGTATTATGG - Intronic
1078261237 11:9710942-9710964 CCTATGTAATCTCAGCACTTTGG - Intronic
1078532470 11:12147893-12147915 TCTATGAAAACTCAGTTTCCTGG - Intronic
1081200014 11:40204189-40204211 CATCTGTAATCCCAGTATTCTGG - Intronic
1087406096 11:97732600-97732622 CCTCTCTAAACTGACTATTCTGG - Intergenic
1091246291 11:134098220-134098242 CATTTGTAAACTAAGTTTTCTGG - Intronic
1092958449 12:13572335-13572357 AATATGTAAAATCTGTATTCAGG + Intronic
1095313234 12:40725870-40725892 CCTATGTAATCTCAGAGTTCTGG - Intronic
1100099908 12:91091072-91091094 CCTCTCTAAACTGACTATTCTGG + Intergenic
1101583015 12:106060585-106060607 CATATGTAAAGTGAGCATTCTGG - Intergenic
1102038761 12:109787234-109787256 CCTATGAAAACCCAGATTTCTGG - Intronic
1105362806 13:19736345-19736367 ATTATGTAATCTCAGTATACAGG - Intronic
1105978134 13:25491521-25491543 ACTATGTAAACTCAGGCGTCGGG - Intronic
1108466072 13:50716350-50716372 CATATAAAAACTCAATATTCTGG - Intronic
1108611393 13:52087551-52087573 ACTAAGCAAACTCAGTATTTGGG + Intronic
1110603056 13:77398648-77398670 CCTAAGTACACTCATTATACGGG + Intergenic
1111013897 13:82351148-82351170 ACTATGTAAACTCAGATTGCTGG + Intergenic
1112103069 13:96211190-96211212 CATCTGTAATCTCAGTACTCTGG - Intronic
1116123835 14:40756150-40756172 CCTCTTTAAACTGGGTATTCTGG + Intergenic
1117048084 14:51833163-51833185 AATATGTAAACACATTATTCAGG + Intronic
1117984993 14:61378464-61378486 CATCTGTAATCTCAGTATTTTGG - Intronic
1120582189 14:86266182-86266204 CCTCTCTAAACTGATTATTCTGG + Intergenic
1121338535 14:93091716-93091738 CCCATTTAACCTCAGTCTTCAGG + Intronic
1124179581 15:27460078-27460100 TTTAGGTAAACTCAGTCTTCAGG - Intronic
1124415306 15:29468841-29468863 CTTATGTAACCCCAGTTTTCAGG + Intronic
1126068399 15:44844304-44844326 CCTATGTAATCCCAGCACTCTGG + Intergenic
1126090432 15:45046501-45046523 CCTATGTAAACCCAGCACTCTGG - Intronic
1131246076 15:90794585-90794607 CATATATAAACTCAATATTCTGG - Intronic
1131932401 15:97458053-97458075 CATATGTAACTTCATTATTCAGG + Intergenic
1137008227 16:35298232-35298254 CCTATTAAAACACAGTCTTCAGG - Intergenic
1138983898 16:62303558-62303580 CCCATGTATACTCAATATTTAGG - Intergenic
1141782496 16:86172917-86172939 CTTATGTAATCTAAATATTCAGG - Intergenic
1142461517 17:97382-97404 CGTCTGTAATCTCAGCATTCTGG + Intergenic
1148068567 17:44892225-44892247 CCTATGTAATCTCAGCATTTTGG + Intronic
1151287506 17:73123644-73123666 CTTATGTAAAAGCAGCATTCAGG + Intergenic
1152144895 17:78562251-78562273 CCTAGGAAAAATCAGAATTCTGG + Intronic
1152954838 18:29364-29386 CCTCTCTAAACTGAATATTCTGG - Intergenic
1156870842 18:41943279-41943301 CCTAAATAAAATCAGTTTTCTGG - Intergenic
1158484405 18:57852491-57852513 TCAATGTAAACTGGGTATTCTGG + Intergenic
1159277170 18:66235826-66235848 CCTCTGTCAACTGATTATTCAGG - Intergenic
1163418215 19:17199802-17199824 CCTATGTAATCTCAGCACTTTGG - Intronic
1165776577 19:38408067-38408089 CTTATGTAAAATGAGTATTAGGG + Intronic
926389164 2:12369767-12369789 GCTGTGTTCACTCAGTATTCAGG + Intergenic
930103013 2:47617694-47617716 CCAATGTAAACTCAGGACTTGGG - Intergenic
930634451 2:53788656-53788678 CACATGTAATCCCAGTATTCTGG - Intronic
933377647 2:81500457-81500479 CCTTACTAAACTCAGTATTTTGG + Intergenic
935434011 2:103008689-103008711 CACATGAAAACTCAGTATCCTGG - Intergenic
935743172 2:106168910-106168932 ACCATTTAAACTCAGTATTTTGG - Intronic
940624402 2:156154459-156154481 CTAATGTAAACTGTGTATTCTGG + Intergenic
943372969 2:187039475-187039497 TGTATGTAAACTCAGGACTCAGG - Intergenic
944556763 2:200894834-200894856 CATCTGTAATCTCAGCATTCTGG - Intronic
946058302 2:216919984-216920006 CCTATGTAAACTCATCCCTCTGG + Intergenic
1170698853 20:18685147-18685169 CATTTGTAAACTCAGTAATTGGG - Intronic
1171774887 20:29355940-29355962 CCTCTCTAAACTGAATATTCTGG - Intergenic
1171902069 20:30867428-30867450 CCTCTGTAATCTCAGCATTTTGG + Intergenic
1173274776 20:41570395-41570417 CCTTTGTGAACTCAGTATCTAGG + Intronic
1173661403 20:44736726-44736748 GCTCTGTGAACTCAGCATTCTGG - Intergenic
1177182924 21:17762786-17762808 TGTCTGTAATCTCAGTATTCTGG - Intergenic
1177209844 21:18057511-18057533 CCTATGTAAACTATGAACTCTGG - Intronic
1179331515 21:40406877-40406899 CATATGTAATCCCAGAATTCTGG - Intronic
1180250232 21:46581309-46581331 CCTCTGTAAACTGGTTATTCTGG + Intergenic
1180335447 22:11573361-11573383 CCTCTGTAATCTCAGCATTTTGG + Intergenic
1181110835 22:20601964-20601986 TTTATGTAAACTCAGAATACAGG - Intergenic
1182496723 22:30713721-30713743 CATCTGTAATCTCAGTATTTTGG - Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949777239 3:7646879-7646901 GCCATGTAAAGTCTGTATTCTGG + Intronic
950797216 3:15520049-15520071 CTTAAGGAAACTCAGTTTTCTGG - Intronic
952148247 3:30557472-30557494 CTTATGTACATTCAGTTTTCAGG + Intergenic
952572423 3:34732798-34732820 CCTCTCTAAACTCGTTATTCTGG - Intergenic
954896168 3:53976858-53976880 CCTATATAAACACAGAACTCTGG - Intergenic
955619981 3:60852741-60852763 CCTCTGTAATCTCAGTACTTTGG + Intronic
960587360 3:119332458-119332480 CCTATGTAATCCCAGCATTTTGG - Intronic
963196934 3:142543193-142543215 CCTATGTCAGATCATTATTCTGG - Intronic
971918907 4:32910792-32910814 CTTCTCTAAACTCACTATTCTGG - Intergenic
972537001 4:40008156-40008178 CCTTGGGAAACTCAGTAGTCAGG - Intergenic
972556437 4:40186199-40186221 CCTATGTAAGCTGAGTAATGAGG + Intergenic
974241388 4:59253110-59253132 CCTAGGTGAACTCAGTCTCCTGG + Intergenic
975741783 4:77436196-77436218 CCTCTGTAAACTGAGGGTTCAGG + Intergenic
976195201 4:82525493-82525515 TTTATGAAAACTCAATATTCAGG + Intronic
982360530 4:154514268-154514290 CCTATGTCTTCTCAGAATTCAGG + Intergenic
983412141 4:167414648-167414670 ACTATGTAAAATCAGTATGTGGG + Intergenic
983494932 4:168431880-168431902 CCCATGAAAACTCAGTAATGAGG - Intronic
983625125 4:169794740-169794762 CCTCTGTAATCTCAGCATTTTGG + Intergenic
986225338 5:5806958-5806980 GCTATGGAATCTCAGTGTTCTGG + Intergenic
988110607 5:26813984-26814006 CCTTTCTAAACTGAATATTCTGG - Intergenic
989182375 5:38591332-38591354 CTAAAGTAAAATCAGTATTCTGG - Intronic
989991145 5:50767736-50767758 AATATGCAAACTCAGTAGTCAGG - Intronic
990579311 5:57152757-57152779 CCTATGAAAGCTCAGTATAGTGG + Intergenic
990885601 5:60588760-60588782 CCTATCAAAAATCAGTATTTAGG - Intergenic
991554719 5:67882646-67882668 CGCCTGTAATCTCAGTATTCAGG + Intergenic
994085629 5:95755177-95755199 CATATATAAACTAATTATTCAGG - Intronic
994312938 5:98297464-98297486 CCTCTGTAAACTCTCAATTCAGG + Intergenic
995291833 5:110465553-110465575 CCTATTTAGACTCAATATTTTGG + Intronic
995560510 5:113376008-113376030 CTGATGTGAACTCAGTGTTCTGG + Intronic
995852823 5:116563861-116563883 CATTTGTAAATTCAGTATTATGG - Intronic
995868113 5:116714389-116714411 CCTAGATTAACTCAGTATGCAGG - Intergenic
998354427 5:141523012-141523034 CCTATGTAAACTCAGTATTCTGG - Intronic
1007883206 6:45190449-45190471 CATATGTAAACTCTGTATACGGG + Intronic
1008723601 6:54389545-54389567 CCTATGTTACCTTAGTACTCTGG + Intronic
1009280384 6:61743376-61743398 ACAATGTAAACTCAGTTATCTGG + Intronic
1009443263 6:63708125-63708147 CATCTGTAATCCCAGTATTCTGG - Intronic
1012574526 6:100776492-100776514 CATATGTAAGATCAGTAGTCTGG - Intronic
1014055336 6:117007954-117007976 CCTATTTTATCACAGTATTCTGG + Intergenic
1014961811 6:127695492-127695514 CCTATGGAATCTCAGAAGTCTGG + Intergenic
1016762538 6:147754085-147754107 CATATGGTAGCTCAGTATTCAGG + Intergenic
1017715387 6:157207396-157207418 CCTCTGTAAACTCAGTATCCAGG + Exonic
1021117643 7:16761793-16761815 CATCTGTAATCTCAGTACTCTGG - Intronic
1021179629 7:17490573-17490595 CTTATGTAAGCTAAGTTTTCAGG - Intergenic
1021746246 7:23744403-23744425 CTTATTTAAAATCAGTATTTTGG + Intronic
1023774860 7:43595537-43595559 CCTTTGTAATCTCAGCATTTTGG - Intronic
1023903374 7:44502540-44502562 CTAATGTAAACTAAGGATTCTGG - Intergenic
1027604127 7:80278732-80278754 CTTACTTAAACTCTGTATTCTGG + Intergenic
1027959870 7:84931336-84931358 CGTCTGTAATCTCAGTACTCTGG - Intergenic
1031239399 7:119219132-119219154 CCCCTGTAAACTCAGGCTTCAGG - Intergenic
1031507326 7:122601695-122601717 TCTATGTAAACTTAGGATTTGGG - Intronic
1033402407 7:141039007-141039029 CCCATGTAATCTCAGCATTTTGG - Intergenic
1033565173 7:142571092-142571114 CCTCTGTAAACTGGTTATTCTGG - Intergenic
1033594856 7:142851225-142851247 CCTATGTAAAGACAGTGGTCTGG + Intergenic
1035753552 8:2012660-2012682 CTTATGTAAACTGTGTACTCTGG - Intergenic
1037283153 8:17266673-17266695 CCTATGTACAGGCAGTATGCTGG - Intronic
1041474679 8:58249998-58250020 CCTCTCTAAACTGATTATTCTGG - Intergenic
1042665091 8:71195664-71195686 CCAATGTAAACTCAGTCCTTGGG + Intergenic
1044311451 8:90697603-90697625 CCTATGTAAACACAGGGTGCTGG - Intronic
1044783284 8:95766057-95766079 CCTATGTAAGCTAAGGATTTTGG - Intergenic
1046997910 8:120544733-120544755 CCTTATTAAACTTAGTATTCAGG + Intronic
1049882346 8:145074864-145074886 CCTCTCTAAACTGAATATTCTGG + Intergenic
1052459105 9:28740914-28740936 CCTCTGTGGACTCAGGATTCAGG - Intergenic
1053483547 9:38434430-38434452 CACATGTAAACTGTGTATTCGGG - Intergenic
1057412100 9:94825793-94825815 CCAATGTAAACTCATATTTCAGG + Intronic
1058470543 9:105273528-105273550 CACATGTAAACTCAGGATGCTGG + Intronic
1058874774 9:109234602-109234624 CCCCTGTAAACCCAGTATTTGGG + Intronic
1061569978 9:131471321-131471343 CCTTTTTAAAATCAGTATTTGGG + Intronic
1062743015 9:138191909-138191931 CCTCTCTAAACTGAATATTCTGG + Intergenic
1062743264 9:138193909-138193931 CCTCTCTAAACTGAATATTCTGG + Intergenic
1062743513 9:138195910-138195932 CCTCTCTAAACTGAATATTCTGG + Intergenic
1187247785 X:17568349-17568371 CATATGTAAGATCACTATTCAGG + Intronic
1188645461 X:32561283-32561305 CCTCTGTAAACTGGTTATTCTGG - Intronic
1190336843 X:49267770-49267792 CCATTGTACACTCAGCATTCAGG - Intergenic
1193458169 X:81756094-81756116 CCTCTCTAAACTGAATATTCTGG - Intergenic
1193605788 X:83566583-83566605 CCTCTCTAAACTGGGTATTCTGG + Intergenic
1194558149 X:95388255-95388277 CCTATGTTCACTCAGGTTTCTGG + Intergenic
1195828438 X:109029070-109029092 ACTATGCAGACTCAGTATTGGGG - Intergenic
1197557394 X:127973200-127973222 CCTCTGTATGCTCAGCATTCAGG + Intergenic
1198457577 X:136832217-136832239 CCCATGTAATCCCAGTATTTTGG + Intergenic
1201070116 Y:10140371-10140393 CCTCTCTAAACTGAATATTCTGG + Intergenic
1201534767 Y:15034407-15034429 CCTCTGTAATCCCAGTATTTTGG + Intergenic