ID: 998360744

View in Genome Browser
Species Human (GRCh38)
Location 5:141584555-141584577
Sequence ATCTCTTCAGACTGAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998360740_998360744 17 Left 998360740 5:141584515-141584537 CCACACACAATGCTTTCTGCATC 0: 1
1: 0
2: 0
3: 25
4: 252
Right 998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG 0: 1
1: 0
2: 0
3: 26
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998360744 Original CRISPR ATCTCTTCAGACTGAAGCAC TGG Intronic
901234246 1:7659102-7659124 GCCTCTTCAGAGTGAAGCAGAGG + Intronic
905487305 1:38311368-38311390 CTCTCTTCAGACTGGGACACTGG - Intergenic
906100364 1:43256464-43256486 AACTCTTCGGACTTAAGGACTGG + Intronic
906479604 1:46191393-46191415 TTCTCCTCAGGCTGAAGCATAGG + Intronic
906751227 1:48263606-48263628 ATGACTTCAGTCTGAAGGACAGG - Intergenic
909300768 1:74010441-74010463 ACTACTGCAGACTGAAGCACAGG - Intergenic
911348052 1:96721239-96721261 AACTCCTCAGACTGAAATACAGG - Intergenic
916671390 1:167024518-167024540 ACCTCTTAATACTGTAGCACTGG - Intergenic
917871196 1:179243524-179243546 ATCTCTCAACACTGTAGCACTGG - Intergenic
919259319 1:195170226-195170248 ATCTCTTCACAGTGAAGAACTGG + Intergenic
919314054 1:195948596-195948618 ATCTCTTCAGCCTGCACCTCGGG - Intergenic
920163299 1:204016577-204016599 ATCTGATCAGTCAGAAGCACAGG + Intergenic
922134538 1:222812181-222812203 CTCTCCTCAGACTCAAGAACAGG - Intergenic
922747508 1:228052934-228052956 ACCTCTCCAGACTGTTGCACTGG - Intronic
924298611 1:242614088-242614110 ATCTTCTCTGACTGAGGCACAGG - Intergenic
1065298552 10:24300228-24300250 ATCTCTTCACACTGTGGGACAGG - Intronic
1066247742 10:33599740-33599762 ATTTCTTTAGACTGAAGTACTGG + Intergenic
1068316899 10:55356496-55356518 ATCTCATCAGCCTGAATCAGAGG + Intronic
1070467274 10:76736259-76736281 ATCTCTGCAGACTCAAGCATGGG - Intergenic
1071087548 10:81880282-81880304 CTCACTTCAGTCTGAAGAACTGG - Intronic
1071289641 10:84179586-84179608 ATTTCTACAGACAGATGCACGGG - Intronic
1080169571 11:29283221-29283243 TTCTATTCACACTGAAACACAGG + Intergenic
1082066328 11:47903659-47903681 ATCTCTTAAGACTGTAGCATTGG - Intergenic
1082177930 11:49083050-49083072 AACTCTTCAGACTGCAGCAGTGG + Intergenic
1082897377 11:58206185-58206207 ATCTCTTCAGAATCCAGCATTGG - Intergenic
1082897913 11:58212758-58212780 ATCTCTTCAGAATCCAGCATTGG + Intergenic
1085643518 11:78208219-78208241 ATCTCTTAACACTGCTGCACTGG + Intronic
1086687789 11:89752810-89752832 AACTCTTCAGACTGCAGCAGTGG - Intergenic
1086718062 11:90087084-90087106 AACTCTTCAGACTGCAGCAGTGG + Intergenic
1087126870 11:94636975-94636997 ATCTCTTTAGAAGGAAGCATGGG + Intergenic
1087754123 11:102037113-102037135 ATGAATTCAGACAGAAGCACTGG + Intergenic
1087993947 11:104780512-104780534 ATCTCTTGAGACTGTACCTCAGG - Intergenic
1088577784 11:111288222-111288244 ATCTCTTCTTTCTGATGCACAGG - Intergenic
1091143373 11:133255263-133255285 ATCTCTCCAGACAGCAGGACTGG - Intronic
1092159669 12:6309453-6309475 ACCTCGTCTGACAGAAGCACTGG - Intergenic
1093567768 12:20628684-20628706 TGCTCTTCACACTGAAGCAAGGG + Intronic
1095504598 12:42881376-42881398 AAATATTCAGACTGAAGCACTGG - Intergenic
1095578429 12:43766208-43766230 ATCTCTTCTCACTTAATCACAGG + Intronic
1096422403 12:51470485-51470507 ATCTTTTCAAACACAAGCACTGG - Exonic
1102431143 12:112883482-112883504 ATCTTTTTAGAGTGAAGCCCTGG - Intronic
1102891771 12:116564842-116564864 AGCTTTTTAGACTGCAGCACAGG - Intergenic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1104644725 12:130488789-130488811 ATCTCTGCAGACCAAAGCCCAGG - Intronic
1105430968 13:20337246-20337268 TTTTCTTCAGAGTGAAGCAATGG + Intergenic
1106904915 13:34395840-34395862 ATCTCTTCAGGGTCAATCACTGG - Intergenic
1107026606 13:35808377-35808399 ATCTTTTCAGTCTTAGGCACTGG + Intronic
1107780946 13:43901653-43901675 TTTTTTTCAGACTGAAGCAGAGG + Intergenic
1108226575 13:48295606-48295628 ATCTCTTAATACAGAAGCAAGGG - Intergenic
1108679625 13:52768528-52768550 CAATCTTCAGACTGAAGAACCGG - Intergenic
1109616701 13:64843344-64843366 ATTTCTTCAGAATGTAGCACAGG - Intergenic
1111274085 13:85924960-85924982 ATCACTGCTGACTGAAGCATCGG - Intergenic
1111581282 13:90226968-90226990 ATCTGTTCAGACAGAAGAACTGG - Intergenic
1112701320 13:102012310-102012332 CTCTTTCCAGACTCAAGCACAGG - Intronic
1113476768 13:110588617-110588639 ATCTCTTCAAACTGATTCACAGG + Intergenic
1114431015 14:22660606-22660628 ACCTCTTAATACTGTAGCACTGG + Intergenic
1114666117 14:24378051-24378073 AGCTCTGGAGCCTGAAGCACTGG - Exonic
1120445798 14:84593965-84593987 CTCTCTTCAGACGTAGGCACAGG + Intergenic
1121712723 14:96051520-96051542 ATCTCCTCAGCATGAAGCTCTGG + Intronic
1122052638 14:99070475-99070497 ACCTCTTCAGACTGTAGAATTGG - Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1202946005 14_KI270726v1_random:27535-27557 ATCTCCTAAGAGTGGAGCACAGG + Intergenic
1125829526 15:42704341-42704363 ATCTCTTCAGGATGGATCACTGG + Intronic
1127725934 15:61750220-61750242 GTCTCCTCAGACTCAAGCAAAGG + Intergenic
1131049495 15:89337115-89337137 ATCTCCTGAGACTGAATCTCAGG - Intergenic
1132245774 15:100295145-100295167 ATATCTTCAGACTGAGGTTCAGG + Intronic
1132537296 16:488807-488829 ATGTCTTCTGACTGAAGGCCAGG - Intronic
1136084406 16:27874413-27874435 AACTCTGGACACTGAAGCACAGG + Intronic
1137020951 16:35426879-35426901 TTCTCTTCAAACAAAAGCACAGG + Intergenic
1138779072 16:59760738-59760760 ATCACTTCCGACTGAGGCAATGG + Intergenic
1139818550 16:69698994-69699016 ACATTTTCAAACTGAAGCACTGG - Intronic
1142850194 17:2701045-2701067 GTTTCTTCAGACAGAAGCACTGG + Intronic
1142976372 17:3647060-3647082 ACCTCTTCAGATGAAAGCACAGG - Intronic
1143782898 17:9238863-9238885 ATCTGTTCAATCTGAAGCTCTGG + Intronic
1144173550 17:12682991-12683013 ATCTCATCAAACTGAACGACAGG + Intronic
1146931043 17:36778322-36778344 ATCTGCACAGACTGAGGCACAGG + Intergenic
1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG + Intronic
1153763087 18:8350449-8350471 CTCTCTTCAGAAAGAAGGACAGG - Intronic
1154155300 18:11939649-11939671 AGCTACTCAGACTGAGGCACAGG - Intergenic
1155245365 18:23903761-23903783 GTCACTTCAGACAGTAGCACTGG - Intronic
1156122857 18:33865436-33865458 ATATCTCCAGACTGAACCAACGG - Intronic
1156910072 18:42401410-42401432 ATCATTTCTGACTGAAGCAAAGG + Intergenic
1158639904 18:59194882-59194904 ATCTCATCAGCATGAAGAACTGG + Intergenic
1165339780 19:35203149-35203171 ATCTCTTGAGACTGTACCCCAGG - Intergenic
925025700 2:605748-605770 GCCTCTTCAGACAGCAGCACTGG - Intergenic
925792602 2:7507522-7507544 ATCTATGGAAACTGAAGCACAGG - Intergenic
927259333 2:21070944-21070966 ATCACTTCATACTGAAACAAGGG + Intergenic
927528476 2:23770905-23770927 TTCTCTCCAGATTGAACCACAGG - Intronic
929230831 2:39558083-39558105 ATGTCTTCAAGCTGGAGCACTGG - Intergenic
930683180 2:54279584-54279606 AGCTCTTGAGACTGCAGCTCTGG - Intronic
932154491 2:69403722-69403744 AAATATTCAGCCTGAAGCACAGG - Intronic
933225973 2:79750138-79750160 ATTTCTTCATATTGAAGCTCTGG + Intronic
934582018 2:95450330-95450352 AACTCTTTAGACTGCAGCAGTGG - Intergenic
934597432 2:95626384-95626406 AACTCTTTAGACTGCAGCAGTGG + Intergenic
934842457 2:97636610-97636632 AACTCTTTAGACTGCAGCAGTGG - Intergenic
941484555 2:166063506-166063528 TTCTCTTTAGAATGTAGCACAGG - Intronic
943008446 2:182416285-182416307 ATCTCTTCAGGATGAAGCAAGGG + Intronic
945616858 2:212081567-212081589 ATGTATTTAGACTCAAGCACAGG - Intronic
947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG + Intronic
948416409 2:237808606-237808628 AACTATCCAGACTGAAGCATGGG + Intronic
948775488 2:240286664-240286686 CTCTCATCAGACTGAAACATGGG + Intergenic
1169017652 20:2304861-2304883 ATCTGGTCAGTCAGAAGCACAGG - Intronic
1170310649 20:14987927-14987949 AAGTCTTCAGAGTGAAGCTCTGG + Intronic
1170873156 20:20226738-20226760 ACCTCATCAGAGTGAAGCCCAGG - Intronic
1171321014 20:24244395-24244417 AACTCTGGAGACTGAAGCTCAGG + Intergenic
1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG + Intronic
1173221254 20:41134804-41134826 ATCTCTTCAGACCTCAGCAGAGG - Intergenic
1173575131 20:44108133-44108155 AACTCTGGACACTGAAGCACTGG + Intergenic
1173933135 20:46838376-46838398 ACCTCTTAAGACTCAAGCTCTGG - Intergenic
1177875844 21:26630532-26630554 ACCTCTTCATACTGTTGCACTGG + Intergenic
1183318963 22:37153433-37153455 AGGTCTGCACACTGAAGCACAGG - Intronic
949861791 3:8512119-8512141 ATGGCTTCAGAGTGAAGCTCAGG - Intronic
951158719 3:19388847-19388869 ATCTGATAAAACTGAAGCACAGG - Intronic
951414290 3:22404266-22404288 CTTTCTTCAGAGTTAAGCACAGG + Intergenic
955413104 3:58668484-58668506 ATCTCATCAGCCGGAAGGACTGG - Intergenic
959602845 3:108208242-108208264 ATATCTTAAAACTGAAGCAGAGG + Intronic
960190185 3:114694906-114694928 AACTCTTCAGACTGTAGTAGTGG - Intronic
963262432 3:143206284-143206306 ATATCTTGAGACCGAAGCCCTGG - Intergenic
967100761 3:186213686-186213708 ATCTCTACAGATTGGAGCCCTGG - Intronic
967726008 3:192863037-192863059 ATCTCTTAATACTACAGCACTGG + Intronic
975198257 4:71552142-71552164 ATCTATTCAGAATGAGGCCCTGG + Intronic
976366827 4:84241973-84241995 ATCTCTTGAGAATGAAGCCCAGG + Intergenic
978367918 4:108002002-108002024 ATCTCTTAATACTGCTGCACTGG - Intronic
980348245 4:131652645-131652667 ATCTCTGGAGACTGATGAACAGG + Intergenic
981245643 4:142534314-142534336 ATCTCTTAATACTGTTGCACTGG - Intronic
984006425 4:174315267-174315289 ATGTATTCTGACTGAAACACAGG + Intronic
987092106 5:14517224-14517246 CTCTCTTCAGACAAGAGCACAGG - Intronic
989749355 5:44873565-44873587 ATCTCATCAAACTGAAGTTCAGG + Intergenic
991114805 5:62942355-62942377 ATCTTGTCAGACTAAAGCACTGG - Intergenic
992037017 5:72789825-72789847 ATCTCCACACACTGAAACACTGG + Intergenic
992149620 5:73890222-73890244 ATCTTTTCAAAGTGAAGAACAGG - Intronic
992260176 5:74961813-74961835 ATATCTACACAATGAAGCACAGG - Intergenic
992541356 5:77767893-77767915 ATCTCTTAATACTGTAGCATTGG - Intronic
992907639 5:81362113-81362135 CTCTCTTGAGACTGGAGAACTGG - Intronic
993418308 5:87665019-87665041 TCCTTTTCAGACTAAAGCACTGG - Intergenic
993733055 5:91445404-91445426 ATCTCTTCAGGCTGTATCATGGG + Intergenic
994699418 5:103114435-103114457 ATCACTTCTGTCTGAAGCTCTGG + Intronic
996066119 5:119081151-119081173 AGCTCTTCTGACTCCAGCACAGG - Intronic
997995186 5:138579495-138579517 ATATCTTCAGCGTGAAGGACAGG + Intergenic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
998529670 5:142872855-142872877 TCCTCTTCTGACTCAAGCACAGG - Intronic
999152304 5:149434250-149434272 GTCTCTCCAGCCTCAAGCACAGG - Intergenic
999950759 5:156647597-156647619 ATTTATTCAGAATGAATCACTGG - Intronic
1002905877 6:1448717-1448739 GTCTCTTCAGAATGAAGCAAAGG - Intergenic
1003812297 6:9797750-9797772 GTCTCTCCATACTGAAGCTCAGG - Intronic
1006441882 6:34058268-34058290 CTCTCTTCATACTGAGGCAGAGG - Intronic
1006609980 6:35288654-35288676 GTCTTTTCAAAATGAAGCACAGG + Intronic
1010553356 6:77250257-77250279 ATGGCTTCAGAATGAAGCACTGG + Intergenic
1011750434 6:90449755-90449777 ATCACTGCATACTGAAGCCCTGG + Intergenic
1012541809 6:100369690-100369712 TTCTCTACAGGCTGAAGCACAGG - Intergenic
1013190504 6:107801121-107801143 ATGTCTTCTGACTGAACCAGAGG + Intronic
1015126183 6:129757233-129757255 ATTTCTTGAGACTGGAGCTCAGG - Intergenic
1017329177 6:153175553-153175575 ATCTCTGGAGCCTGCAGCACAGG - Intergenic
1020210706 7:6156146-6156168 ATCTCTTGAAACTGAAACCCTGG + Intronic
1021628591 7:22621164-22621186 GTATCTTCAGACTGAAACAGTGG + Intronic
1021909063 7:25365997-25366019 ATCTATTCAGCCTGCAGCATGGG + Intergenic
1024547726 7:50536381-50536403 ATCTCTTGAGGCTGTATCACAGG + Intronic
1024595793 7:50936177-50936199 ATATTTTCAGACTGTGGCACAGG - Intergenic
1027460300 7:78443836-78443858 CTCTCGTCAAACTGAAGCCCAGG - Intronic
1030799422 7:113830672-113830694 ATCTATTCAGCCTGACACACAGG + Intergenic
1034176607 7:149104841-149104863 CCCTCTTCAGGCGGAAGCACCGG + Exonic
1034969332 7:155409362-155409384 AGCCCTTCAGAGAGAAGCACTGG + Intergenic
1037212711 8:16411259-16411281 ATCTCATAAGACTGCAGGACGGG + Intronic
1038525838 8:28272568-28272590 TTCTCTTCAGGCTGCAGCACTGG - Intergenic
1042096021 8:65216915-65216937 AACTCTAGACACTGAAGCACAGG + Intergenic
1042612497 8:70614311-70614333 ATGTCTGCAGACTGCAGTACTGG + Intronic
1043958212 8:86387127-86387149 ATGCCATCAGACTGAAGCAGAGG + Intronic
1045048525 8:98301885-98301907 ATCTTTTCAGAGAGGAGCACAGG - Intergenic
1045182963 8:99805975-99805997 ATCCCTTCTGCCTGAAGCCCAGG - Intronic
1046037777 8:108864700-108864722 ATGACTTTAGCCTGAAGCACTGG + Intergenic
1047622508 8:126622203-126622225 TACTCTTCAGACTTAAGCACAGG + Intergenic
1047776565 8:128076246-128076268 AGCTCTTTAGACTGAATAACTGG + Intergenic
1048983253 8:139714619-139714641 AACTCTGCAGTCTGGAGCACTGG + Intergenic
1050790518 9:9463108-9463130 GCCTCTTCAGACTGAACCACAGG + Intronic
1052360231 9:27547640-27547662 ATTTCTACAGACTGAATCCCAGG + Exonic
1052999542 9:34570041-34570063 CTCTCTTCAGACTGAAGGTCAGG - Intronic
1053346536 9:37382630-37382652 ATCTCTTCAGACACAGGCCCTGG - Intergenic
1056599597 9:88036395-88036417 ATGTCTTCAGTCTAAAGCAGGGG + Intergenic
1057236631 9:93366436-93366458 ATCTCTTCAGAGTCAAACAATGG - Intergenic
1058351282 9:104027639-104027661 ATCTCTTCTCACTGAAGAACTGG - Intergenic
1058476705 9:105342054-105342076 TTCTCTTCAGTCTGATGAACAGG + Intronic
1059184706 9:112257512-112257534 ATATTTTCAGACTGTAACACAGG + Intronic
1060167829 9:121434101-121434123 ATCTCTTTAGTCTGAGGCAAAGG - Intergenic
1060719437 9:125965505-125965527 ATCTCTTCAGAAGGGAGCAGTGG - Intronic
1187634039 X:21206578-21206600 ATCTCTTTAGACTCAGTCACTGG - Intergenic
1187924554 X:24238049-24238071 CTCTCTACTGACTGAAGGACCGG - Intergenic
1188769771 X:34138119-34138141 CTCCCTCCAGACTGAAACACAGG + Intergenic
1200018639 X:153183416-153183438 CTCTCTTCAGAGTGAAGAATGGG - Exonic