ID: 998361190

View in Genome Browser
Species Human (GRCh38)
Location 5:141589191-141589213
Sequence AAGAATAAGCATGAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 1, 2: 6, 3: 80, 4: 1027}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998361190 Original CRISPR AAGAATAAGCATGAGAAAGA AGG Intronic
900766992 1:4512428-4512450 AAGAATCAGAGAGAGAAAGAGGG + Intergenic
900904633 1:5545427-5545449 AATAATAACCAAGAGAAAGCAGG + Intergenic
901284553 1:8066707-8066729 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
901350486 1:8591304-8591326 AAGAATGGTCAAGAGAAAGATGG + Intronic
901385926 1:8909183-8909205 AAGAAAAAGCAGGAGAGAGCGGG - Intergenic
901920764 1:12535360-12535382 AAGAATCAGCTGGAGAAATATGG - Intergenic
902391819 1:16111325-16111347 AATAAAAAGTTTGAGAAAGAGGG - Intergenic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
902826999 1:18982072-18982094 AAGAAAAAGAAAGAGAAAGAAGG + Intergenic
903296559 1:22347059-22347081 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
904260141 1:29283408-29283430 AAGGAGGAGCCTGAGAAAGAAGG - Intronic
904371521 1:30050473-30050495 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
904414607 1:30350692-30350714 TATAATAAGCATAAGAAAGCTGG - Intergenic
904725665 1:32545774-32545796 AAGTTTATACATGAGAAAGAGGG - Intronic
905716548 1:40156331-40156353 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
905978919 1:42204968-42204990 AAGAATGAAAATGAGAGAGAGGG + Intronic
906157492 1:43622277-43622299 GAGAAGAAGCATGAGAAATGCGG - Exonic
906230538 1:44159102-44159124 AAGAAAAACAAAGAGAAAGAAGG - Intergenic
906579011 1:46919163-46919185 AAAAATAACCATCAGAAAGTAGG - Intergenic
906629084 1:47350091-47350113 AATAATAAGGCTGAGCAAGATGG - Intronic
906658003 1:47562648-47562670 AAGAATATGCATAAAAGAGATGG - Intergenic
906794504 1:48686572-48686594 AAGAAGAAACAAGAGAAAAAAGG + Intronic
906937576 1:50227375-50227397 AAGAGTAACCAAGAGAAAGTGGG - Intergenic
907066103 1:51484610-51484632 AAGAATCAGAACAAGAAAGATGG - Intronic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
907600015 1:55760024-55760046 AACAATAACCATGAGAGAGTTGG + Intergenic
907611638 1:55877029-55877051 AAGAATAAACATGTGTAGGAAGG - Intergenic
907656690 1:56350267-56350289 AAACATAAGCATAAGAAAGCTGG - Intergenic
907868866 1:58424813-58424835 AACATTAAGCATGAGGGAGAAGG + Intronic
908120113 1:60978385-60978407 AAGTATAAGACTGAGAATGAGGG + Intronic
908701575 1:66907963-66907985 AAGAGATGGCATGAGAAAGATGG - Intronic
908744944 1:67367421-67367443 AAGAAAAAGAAAAAGAAAGAAGG + Intronic
908819705 1:68072220-68072242 AATACTAAGCAAGAGAAAGTTGG - Intergenic
909640470 1:77866564-77866586 AATACTAAGGATGAGAAAGAAGG - Intronic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909797640 1:79762928-79762950 AAGACTAAAATTGAGAAAGAAGG - Intergenic
909829893 1:80174691-80174713 AAGACCAAGCAAGAGAGAGAGGG + Intergenic
910039426 1:82831196-82831218 CAGAGTATGCATAAGAAAGACGG + Intergenic
910076896 1:83291293-83291315 AACAATAAGGCTGAGTAAGAGGG + Intergenic
910204819 1:84738617-84738639 AAGAAGAAGGAAGAGAAATAAGG - Intergenic
910376118 1:86573160-86573182 TAAATTAAGCAGGAGAAAGACGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911115146 1:94238416-94238438 AAAAAAAAGTCTGAGAAAGATGG + Intronic
911118036 1:94266277-94266299 AGGAATAAGCATGCCATAGAAGG - Intronic
911314832 1:96343326-96343348 TAGAATGACCATGAGATAGAAGG - Intergenic
911390997 1:97242931-97242953 AAGGATAATCATGAAAAAAAGGG + Intronic
911519329 1:98909306-98909328 AAGAATAAAGAACAGAAAGAAGG - Intronic
912033366 1:105278226-105278248 AAGAATAATCATTAGAGAAAAGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912316130 1:108668905-108668927 AAAAATAAAAATGAGAGAGAGGG + Intergenic
912769344 1:112448777-112448799 AAGAAACAGCATTAGAAAGGTGG - Intronic
913031387 1:114907143-114907165 AACAACAAGCATAAGAAACATGG - Intronic
913136619 1:115896671-115896693 AGGAGTAAGAATGAGGAAGATGG - Intergenic
913192260 1:116423126-116423148 AAGAACAAGCATGACAGGGAAGG + Intergenic
913297536 1:117336431-117336453 AAGAAAAAAAATGCGAAAGAGGG + Intergenic
913352200 1:117874349-117874371 AAGAGAAAGCAAGAGAGAGAAGG - Intronic
913553844 1:119943846-119943868 AAGCATGAACATGACAAAGAGGG + Intronic
913573638 1:120146746-120146768 AAAAATGAGTTTGAGAAAGACGG + Intergenic
914294896 1:146311549-146311571 AAAAATGAGTTTGAGAAAGACGG + Intergenic
914439376 1:147690533-147690555 CAGAATCAGCTTTAGAAAGATGG - Intergenic
914469092 1:147958074-147958096 AAAAAAAAGAATGATAAAGAAGG + Intronic
914555937 1:148762332-148762354 AAAAATGAGTTTGAGAAAGACGG + Intergenic
914907478 1:151758360-151758382 AAGCACCAGCATGAGCAAGATGG + Intergenic
914964771 1:152245760-152245782 TAGAATATGCATGTGTAAGAGGG + Intergenic
915378090 1:155415774-155415796 AAGAAGAAGTATCAGAAAGCAGG - Exonic
915627657 1:157125455-157125477 CAGAACAAGCTTGAGAATGAAGG + Exonic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
915782832 1:158571927-158571949 AACAAAAAGAAAGAGAAAGATGG + Intergenic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916164126 1:161949680-161949702 GAGAAGCAGCAAGAGAAAGAGGG + Intronic
916471074 1:165123040-165123062 AAGAATATGAATGAAAGAGAAGG - Intergenic
917030015 1:170679982-170680004 AAAAATCAGCATCAGAAAAAAGG - Intronic
917459368 1:175216266-175216288 AAGAAAATAGATGAGAAAGAAGG - Intergenic
917730539 1:177870608-177870630 AAGCAGAAGGATGAGAAAGGAGG + Intergenic
917966835 1:180184124-180184146 AGGAAGAAGAATGAGCAAGAGGG - Intronic
918225604 1:182478638-182478660 AAGGAGAAGCAAGAGAAAAAGGG + Intronic
918412732 1:184277083-184277105 GAGAAAAAGCAAGAGAGAGAGGG - Intergenic
919426914 1:197444327-197444349 AAGAAAATGGATGAGTAAGAAGG - Intronic
919577186 1:199325098-199325120 AAGCAAAAGCATTACAAAGAAGG + Intergenic
919615782 1:199806776-199806798 ATTATTGAGCATGAGAAAGAAGG - Intergenic
919635363 1:199998526-199998548 AAAAGTAAGCAAGAGAGAGAAGG - Intergenic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
919965671 1:202521683-202521705 AAGAAAATGAAAGAGAAAGATGG + Intronic
920089258 1:203440818-203440840 CAGAAAGAGAATGAGAAAGAGGG + Intergenic
920275995 1:204804761-204804783 AAGAAAAAGAAAGGGAAAGAAGG + Intergenic
920859806 1:209696538-209696560 AATTATAACCATGAGAGAGAAGG + Intronic
920988342 1:210911897-210911919 AAGAATCAGGAAGGGAAAGAGGG - Intronic
921083034 1:211758756-211758778 AAGATTAAGAATGAAAGAGAAGG - Intronic
921326317 1:213988879-213988901 AAGAGAGAGCAGGAGAAAGAAGG - Intronic
921777629 1:219120577-219120599 AAGTATTAACATAAGAAAGAAGG + Intergenic
921890582 1:220349407-220349429 AAGAGTAAGCCTGGCAAAGATGG + Intergenic
922233070 1:223702882-223702904 AAGAAAAACCAGGAGAAGGAGGG + Intronic
922310283 1:224382230-224382252 AACAAAAAGCAGGAGCAAGAAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
924003034 1:239574770-239574792 AAGAAAAAAGATGAAAAAGAAGG - Intronic
924045340 1:240024001-240024023 AAAATTAAGAATGAGAAGGATGG + Intronic
924865521 1:247975329-247975351 AAAGGTAAACATGAGAAAGAGGG - Intronic
1063065803 10:2607318-2607340 AAGAAAAAGCATAAAAAAAAAGG - Intergenic
1063068801 10:2637854-2637876 AACAATAAGCATGGGCAAGGTGG + Intergenic
1063491295 10:6465969-6465991 AAGAGGTAGCATGAGAAAGCAGG - Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064610748 10:17099481-17099503 CAAAATAAGCATGAAATAGAAGG - Intronic
1064660863 10:17606312-17606334 AAGAAGTAGTATGAGAAAGCTGG - Intronic
1064884555 10:20096040-20096062 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1064920137 10:20507802-20507824 AAGAACAAGCATGTAACAGATGG + Intergenic
1064988218 10:21232180-21232202 AAGAAGAAGCATAGGAAACAAGG + Intergenic
1065444337 10:25781970-25781992 GAAAAGAAGCAGGAGAAAGAAGG + Intergenic
1065615369 10:27516123-27516145 AAGAATAAGCATTAAAAATAAGG - Intronic
1065819132 10:29509279-29509301 AAGAGAAAGAAAGAGAAAGAGGG + Intronic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1066458664 10:35594441-35594463 AAAATTAAGTATGAGAAAAACGG - Intergenic
1067026805 10:42849423-42849445 AACAAAAAGCCTGAGCAAGAGGG - Intergenic
1067334851 10:45352363-45352385 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1068201437 10:53788717-53788739 AAGAAAATGAAAGAGAAAGAAGG + Intergenic
1068640107 10:59394722-59394744 AAGAGTAAGCAAGGGAAAGGTGG - Intergenic
1068789884 10:61016695-61016717 AAAAATAAGAAAGAGAAATAAGG + Intergenic
1068878080 10:62018931-62018953 AAGAATACACATTAGAAAGATGG - Intronic
1068905900 10:62321960-62321982 AAGATTAAGAAAGACAAAGAAGG + Intergenic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1068983556 10:63086525-63086547 CACAAAAAGCAAGAGAAAGAAGG - Intergenic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1069195299 10:65544124-65544146 AAGAATAAGAAGGAGGGAGAGGG - Intergenic
1069299059 10:66884062-66884084 AAGAGGAAGCATGAGAGAGGGGG + Intronic
1070296785 10:75168670-75168692 AAAAACAAGAATGATAAAGAAGG - Intronic
1070567500 10:77614929-77614951 CAGAATAAGCTTGAGATAAAAGG + Intronic
1070603399 10:77881435-77881457 AAAGGGAAGCATGAGAAAGAAGG + Intronic
1070721538 10:78760610-78760632 AAGAAAAACAAAGAGAAAGAAGG - Intergenic
1070835805 10:79446110-79446132 AAGAAGGAGTATGAGAAAGGAGG - Intergenic
1071441174 10:85697432-85697454 AACAGTAAGCATAAGAAAGCTGG - Intronic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071536802 10:86440129-86440151 AGGAATTAGCATGGGAAAGATGG + Intronic
1071695507 10:87864428-87864450 AAGAAAAAGGAGGAGAGAGATGG - Exonic
1071762202 10:88620972-88620994 AAGAAGAGACATGAGAAAAATGG - Intergenic
1072064935 10:91858705-91858727 GAGAATAAGAATGTGAAAGTTGG + Intronic
1072785607 10:98278300-98278322 AAGTATAAAGATGAGAAGGAAGG + Intergenic
1072907918 10:99471925-99471947 AAGAAAGAGAAAGAGAAAGAAGG + Intergenic
1072986460 10:100145291-100145313 AAAAAAAAAAATGAGAAAGATGG - Intergenic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073536284 10:104279549-104279571 AAGAATAAGCCTGTGAAAGCTGG - Intronic
1073679492 10:105687027-105687049 AAGCTGAAGCAGGAGAAAGAGGG + Intergenic
1073723673 10:106204703-106204725 AATAATAAGGGTGAGAAGGATGG + Intergenic
1073736905 10:106358835-106358857 AAGAATGGGCATAGGAAAGAAGG + Intergenic
1074278327 10:112025814-112025836 AAGAATAAGCAAGAAAGGGATGG - Intergenic
1074394129 10:113083363-113083385 AAAAATAATAATGAGAAAAAAGG + Intronic
1074715817 10:116217631-116217653 AATAATAAGCAATAGAAACAGGG + Intronic
1075234814 10:120717753-120717775 AACACTAAGCATTAGAAAGCTGG + Intergenic
1075271476 10:121055556-121055578 AAGAATGAGAATGGGAAAAATGG - Intergenic
1075328350 10:121553252-121553274 AAGAGGAAGGAGGAGAAAGAAGG + Intronic
1075576266 10:123579937-123579959 AAGATTAAACATGAGAAGCAGGG - Intergenic
1075742377 10:124703739-124703761 AACAAAAAGCAGCAGAAAGAAGG + Intronic
1075824806 10:125346465-125346487 AAAAAGAAGCATAAAAAAGAAGG - Intergenic
1075989356 10:126821626-126821648 TACTTTAAGCATGAGAAAGATGG + Intergenic
1077418765 11:2438721-2438743 AAGAATCAGCATCATTAAGATGG + Intergenic
1078167745 11:8903485-8903507 AAAAAAAAGCAAGAGAGAGAAGG + Intronic
1078400324 11:11020557-11020579 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1078634899 11:13040300-13040322 AAGAAAAAGAATGAGAGGGATGG - Intergenic
1078806269 11:14708211-14708233 AAAAAGAAGCAAGAGAGAGATGG - Intronic
1079051886 11:17168029-17168051 AGGAATAAGGAAGAGAAAGAAGG + Intronic
1079142988 11:17825781-17825803 AAGAATAAGAAACAGCAAGATGG + Intronic
1079431102 11:20388600-20388622 AAGAATTAGCATGGTAAAGCCGG - Intronic
1079567320 11:21898952-21898974 AAGAATATGCATTTTAAAGAAGG - Intergenic
1079583884 11:22101231-22101253 AAGAAAAACCAAGAAAAAGATGG + Intergenic
1079946236 11:26745288-26745310 AAGAAAAAGGGAGAGAAAGAAGG - Intergenic
1079949187 11:26780675-26780697 AAGCATAAACATAAGAAAGGAGG + Intergenic
1080359863 11:31500289-31500311 AAACACGAGCATGAGAAAGAAGG + Intronic
1080665188 11:34329729-34329751 AAGAGTAAGCAAAAGAAACAGGG + Intronic
1081456193 11:43225361-43225383 AAAAGTAAGCATCAGAGAGAGGG - Intergenic
1081493514 11:43584077-43584099 CAGAGTGAGCCTGAGAAAGACGG - Intronic
1081681136 11:45004157-45004179 AACATTAAGCATTAGAAAGCTGG - Intergenic
1082255863 11:50032193-50032215 AAGAGTGAGCATGAAAAAAAGGG + Intergenic
1082908722 11:58344578-58344600 GAGAACAAACATGATAAAGAAGG + Intergenic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083084894 11:60132949-60132971 AAGAATAAGCAAGATACAGTGGG + Intergenic
1084441474 11:69176553-69176575 AAGAATGAGGAGGAGAAATAAGG - Intergenic
1084472744 11:69372783-69372805 AAGAACAAGCAAAATAAAGAAGG + Intergenic
1084523987 11:69684666-69684688 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1084644483 11:70447055-70447077 AAGAATGAGACAGAGAAAGATGG - Intergenic
1085579204 11:77635893-77635915 AAGAAGAAACTTGAGAAAGGAGG - Intronic
1085637621 11:78170567-78170589 TGGCAAAAGCATGAGAAAGACGG - Intergenic
1085640506 11:78189761-78189783 AAGGATAAGGAGGAGAGAGAAGG - Intronic
1085805721 11:79634047-79634069 AAGAACAAGAAAGAGAATGAGGG - Intergenic
1085986926 11:81799120-81799142 AAGCAAAAGCATGAGCAAGAGGG - Intergenic
1086075343 11:82844888-82844910 AAAATTAAGCATGAGACAGCAGG - Intronic
1086242439 11:84711681-84711703 AACAAAAAGCCTGAGTAAGAGGG - Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086332151 11:85764759-85764781 GAGGATATGCATGAGATAGAGGG + Intronic
1086372601 11:86169944-86169966 AAGCAAAATCATGGGAAAGAGGG + Intergenic
1086431964 11:86744686-86744708 AAAAAAAAGAAAGAGAAAGAAGG + Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1086852931 11:91832470-91832492 AAGAATGAGGAAGAGACAGATGG - Intergenic
1087834347 11:102856971-102856993 AACACTAATCATAAGAAAGATGG - Intergenic
1087954166 11:104264344-104264366 AAAAAGAGGCATGAGAAAAATGG - Intergenic
1087982581 11:104634364-104634386 AAGGAAAAGAATGAGAAAGGAGG + Intergenic
1088551313 11:111015023-111015045 AAGAATAAGGAAGAGAAAGTAGG + Intergenic
1088559104 11:111094805-111094827 AAGAATAAGAATCAGAATGATGG - Intergenic
1088726532 11:112642084-112642106 AAGAGAAAGGAGGAGAAAGAAGG - Intergenic
1089359250 11:117875446-117875468 AGGAATGGGCAGGAGAAAGAGGG + Intronic
1089592442 11:119552293-119552315 AAGAATTAACATAACAAAGAAGG + Intergenic
1089839270 11:121400252-121400274 AAGAGGAAGCAAGAGAGAGAGGG - Intergenic
1090025380 11:123163096-123163118 AAGAAGAGTCAGGAGAAAGAAGG + Intronic
1090521443 11:127483913-127483935 AAGATTAGGCATGAGCAAAAAGG + Intergenic
1090522699 11:127496164-127496186 ATGAAAAAGCATCAGAGAGAAGG + Intergenic
1090933309 11:131319243-131319265 GAGAACAAGAATGAGAAAAAAGG - Intergenic
1091012648 11:132019645-132019667 AACAGTAACCATAAGAAAGAAGG - Intronic
1091289581 11:134430262-134430284 AAGTACAAGCTGGAGAAAGACGG - Intergenic
1091331497 11:134734861-134734883 TAGAATAAACAGGAGAGAGAGGG - Intergenic
1091538327 12:1435017-1435039 AAAAACAAACATGAGGAAGACGG - Intronic
1092042345 12:5395771-5395793 AGGAAGAAACATGAGGAAGAAGG - Intergenic
1092109323 12:5947790-5947812 GAGAATACCCATGAGAAAGAAGG - Intergenic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092485481 12:8899021-8899043 AAGAATAGGCCTGAGAGACAAGG - Intergenic
1092513134 12:9179195-9179217 AAGAATAATTATCAGAAGGAAGG - Intronic
1092719209 12:11424307-11424329 AAGAAGAAGGCTGAGAAAGAGGG - Intronic
1093053204 12:14527860-14527882 AACAGTAAGCATAAGAAAGCTGG + Intronic
1093565556 12:20598869-20598891 AACAATAAACATGGGAAACAAGG - Intronic
1093867176 12:24242138-24242160 AATAATAAACATCATAAAGATGG + Intergenic
1093886358 12:24466089-24466111 AAAAATAAGAAAGAGAAAGAGGG + Intergenic
1094070293 12:26405146-26405168 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094337138 12:29372379-29372401 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1094651662 12:32384709-32384731 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1094731834 12:33185598-33185620 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1095149985 12:38782582-38782604 CAGAAAGAGAATGAGAAAGAGGG + Intronic
1095159676 12:38902211-38902233 AAGAAAGAGAAAGAGAAAGAAGG + Intronic
1095645243 12:44537280-44537302 ATTACTATGCATGAGAAAGAGGG - Intronic
1095694356 12:45127965-45127987 AAGAACAAGGGGGAGAAAGAGGG - Intergenic
1095730594 12:45502430-45502452 AAGAATAAGAATGGCAAAGCTGG - Intergenic
1096321355 12:50616617-50616639 AAGAAACAGCAAGAGAAATAGGG + Intronic
1096350387 12:50893857-50893879 AAAAATAAGCATGAAAAAAGGGG + Intergenic
1097681309 12:62651978-62652000 AAGAAGGAGCATCAGAGAGAAGG - Intronic
1098019714 12:66140908-66140930 AGGAATAAATATAAGAAAGATGG + Intronic
1098287258 12:68920074-68920096 AAGCAGAAACAAGAGAAAGAGGG - Intronic
1098469373 12:70826116-70826138 AAGAAGAAGGGAGAGAAAGAAGG + Intronic
1098655135 12:73018776-73018798 AATAATAAGCATAAGTAAGTGGG + Intergenic
1098769371 12:74534611-74534633 TGGAGAAAGCATGAGAAAGAAGG + Intergenic
1098814704 12:75143682-75143704 AAGAATAAACATGAGAATCCAGG - Intronic
1099061358 12:77913850-77913872 AAGCACAATCATCAGAAAGAAGG - Intronic
1099249634 12:80237350-80237372 AAGAAAAAGGTAGAGAAAGAAGG + Intronic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1099417337 12:82407637-82407659 AAGAATAAGCAGGAGGAAACAGG + Intronic
1099538948 12:83881312-83881334 AAGCATAAGCAATACAAAGAAGG - Intergenic
1100205823 12:92348200-92348222 AAGGGTAAGGAAGAGAAAGATGG + Intergenic
1100648424 12:96557318-96557340 GACAATAAGCAAAAGAAAGAAGG + Intronic
1100878483 12:98989923-98989945 AAGAGAAAGAAAGAGAAAGAAGG + Intronic
1100917047 12:99435959-99435981 AGGAAAAAAAATGAGAAAGAAGG - Intronic
1100917269 12:99438592-99438614 AAGAATTAGCAGTAGATAGATGG - Intronic
1101115050 12:101523667-101523689 AAGAAAAAGAAAGAGAAAAAAGG + Intergenic
1101124643 12:101619309-101619331 AAGAGAAATCAGGAGAAAGAAGG - Intronic
1101662881 12:106782013-106782035 AAGAACAAGAAAAAGAAAGAAGG - Intronic
1101752389 12:107592988-107593010 ATGAATATGCATTATAAAGAAGG + Intronic
1101960834 12:109248632-109248654 TAGAAAAAGCAGGTGAAAGAAGG - Intronic
1101964138 12:109270551-109270573 AAGAATGACCCTGAGAAAAAAGG - Intergenic
1102023830 12:109701922-109701944 AAATAAAAGCATGAGAAAGTTGG + Intergenic
1102772621 12:115491731-115491753 GAGAATAAGTCTAAGAAAGACGG - Intergenic
1103886527 12:124206503-124206525 AATGAGAAGAATGAGAAAGAAGG - Intronic
1103924519 12:124416254-124416276 AAAAATGAGCAAAAGAAAGAGGG + Intronic
1104091464 12:125521275-125521297 AAGAAGGAGAAGGAGAAAGAAGG - Intronic
1104162798 12:126196646-126196668 AAGAATATGGATGACAAATAAGG + Intergenic
1104351875 12:128051262-128051284 AAGAATAATAATGAAGAAGAGGG + Intergenic
1105450342 13:20493660-20493682 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1105644050 13:22297795-22297817 AAGAATAAGGGAGAGAAAAATGG + Intergenic
1105993971 13:25652477-25652499 AAAAATAAGAATAAGGAAGAGGG - Intronic
1106254253 13:28008418-28008440 AAGAAGAAGAAGGGGAAAGAGGG - Intronic
1106713359 13:32361802-32361824 AAGAGTATGAATGAGAAAGGAGG + Intronic
1106767578 13:32930285-32930307 AACAGCAAGCATAAGAAAGATGG - Intergenic
1107406154 13:40115767-40115789 AAGAATAAACACGAGAAGGGTGG - Intergenic
1107533028 13:41302407-41302429 AAAAATAAGCCTGAGAACAAAGG - Intergenic
1108770416 13:53693884-53693906 GAGAATGAGCAAGAGAGAGAGGG + Intergenic
1108891567 13:55266996-55267018 AAGAATATGAAAGAGAAATAGGG - Intergenic
1109133793 13:58622621-58622643 AAGAATGTGCTTGCGAAAGATGG - Intergenic
1109180644 13:59210337-59210359 AAGGAAAAGAAAGAGAAAGAAGG + Intergenic
1109327264 13:60882939-60882961 AAGAATAAGCAAAGGACAGAAGG + Intergenic
1109345034 13:61104555-61104577 AATAACCTGCATGAGAAAGATGG - Intergenic
1109448691 13:62480258-62480280 GAGCAAAAGAATGAGAAAGAGGG + Intergenic
1109566775 13:64128293-64128315 AAGAAAGACCATGAAAAAGAAGG + Intergenic
1109914355 13:68961337-68961359 AAGAATAAGCATCACAAAAGAGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110290235 13:73797357-73797379 AAGAATAAGATGAAGAAAGAAGG - Intronic
1110406452 13:75155882-75155904 AAGCAGAAGCAAGAGAGAGAGGG + Intergenic
1110835985 13:80083602-80083624 AAAAATAAACCTGAGAAAAAGGG + Intergenic
1111238555 13:85442597-85442619 GATGATAAGCAAGAGAAAGAGGG - Intergenic
1111660981 13:91211382-91211404 AAAAATAGGCATGAGACACAGGG - Intergenic
1111952163 13:94717365-94717387 AAGAACAAACCTGAGAAAGGGGG + Intergenic
1112691237 13:101896969-101896991 ACAAATAAGGATAAGAAAGATGG + Intronic
1112876212 13:104042666-104042688 AACAACAATAATGAGAAAGATGG + Intergenic
1114877499 14:26739597-26739619 AAGCAGAAGCAAGAGAGAGAGGG - Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1115009304 14:28524789-28524811 AAGAAGGAGAAAGAGAAAGATGG + Intergenic
1115054678 14:29108932-29108954 AAGAGAAAGAAAGAGAAAGAAGG + Intergenic
1115221092 14:31059297-31059319 AAGAACAAGGATGACAAATAAGG - Intronic
1115836659 14:37413453-37413475 AAGAATAAGAACCAGAGAGATGG - Intronic
1116669617 14:47823999-47824021 AATAATAAGAATGAAGAAGAGGG + Intergenic
1116698446 14:48204954-48204976 AAGAGTAAGCTTTAGAATGACGG + Intergenic
1116744715 14:48802891-48802913 AAGAATAAGAATATGAGAGATGG + Intergenic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117404315 14:55387121-55387143 AAGATTGAGCAAGTGAAAGAGGG - Intronic
1117667829 14:58076010-58076032 AGGAAGAAGAATAAGAAAGAAGG + Intronic
1118269098 14:64325357-64325379 ATGAATTTGCATTAGAAAGAAGG + Intronic
1118351754 14:64977103-64977125 AAGAAAAAGCATGTGAATGGAGG - Intronic
1118674782 14:68172005-68172027 TAAAATAAGAATGAGAAATATGG - Intronic
1120503844 14:85329472-85329494 AAGAATAATTATGTGAAAGTTGG + Intergenic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120519099 14:85505481-85505503 AAGAATAAGGATGAAATACATGG - Intergenic
1120841636 14:89090693-89090715 AAGAATGATCATAAGAAAAAAGG - Intergenic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121529853 14:94644587-94644609 AAGAATAAGAATCCCAAAGAGGG - Intergenic
1121841715 14:97139882-97139904 GAGAATAAGAGTGAGAAAGATGG + Intergenic
1121937975 14:98037926-98037948 AAGAAAGAACATGAGAGAGAGGG - Intergenic
1121965688 14:98302405-98302427 AAAAATAAGAGGGAGAAAGAGGG - Intergenic
1122146882 14:99695937-99695959 AACACTAAGCATAAGAAAGCTGG - Intronic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1122946030 14:105010046-105010068 TAGAGAAAGCATGAGAAACAGGG + Exonic
1123132133 14:105996177-105996199 AAGACAACGGATGAGAAAGAGGG + Intergenic
1124107552 15:26754219-26754241 AAGAGTAAGAATGGGAGAGAGGG + Intronic
1124916397 15:33978879-33978901 AAGAACAAACATGTGAAAAATGG + Intronic
1125093995 15:35829935-35829957 GAGAAGAAGCAAGAGAGAGAGGG + Intergenic
1125383610 15:39113735-39113757 GAGAAGAAGCCTGAGAAGGAAGG + Intergenic
1125480632 15:40077272-40077294 AAAAAAAAGAAAGAGAAAGAGGG + Intergenic
1126066354 15:44828991-44829013 AACTATAAACATGAGACAGATGG + Intergenic
1126093528 15:45071875-45071897 AACTATAAACATGAGACAGATGG - Intronic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126632144 15:50747157-50747179 GAAAATAAGCAAGAGAAAGTGGG - Intronic
1126871297 15:52991167-52991189 AAGAATAAGTATCATAAAAATGG - Intergenic
1127216497 15:56828711-56828733 AAGAATAAGAATTAGAAAGAAGG + Intronic
1127487675 15:59434630-59434652 AGGAACTAGCAGGAGAAAGAAGG - Intronic
1127507389 15:59610364-59610386 GAGAAAAAGAAAGAGAAAGAAGG - Intronic
1128024566 15:64424228-64424250 AAGAAAAAGCCAAAGAAAGAAGG - Intronic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128206708 15:65859083-65859105 AAGAGAAAGAAAGAGAAAGAGGG - Intronic
1128262510 15:66242433-66242455 AAGAAAAAGAAGAAGAAAGAAGG + Intronic
1128508539 15:68298626-68298648 AAAAATAAAAATAAGAAAGATGG + Intronic
1128751232 15:70151315-70151337 AAGACTAAGAAAGAGAAAAAAGG - Intergenic
1129035044 15:72643973-72643995 GAGAATAAGCAAGAGAGAGGAGG + Intergenic
1129180959 15:73875263-73875285 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
1129214838 15:74093243-74093265 GAGAATAAGCAAGAGAGAGGAGG - Intergenic
1129735845 15:77962511-77962533 AATAATAAGTTTAAGAAAGATGG + Intergenic
1129816967 15:78563916-78563938 ATCAATAATCATGAGAATGATGG - Intergenic
1129927255 15:79375610-79375632 AAGCAGAAGCAAGAGAGAGAGGG + Intronic
1129955488 15:79632863-79632885 AAGAACAGGCATGAGAAAGATGG + Intergenic
1130033804 15:80340394-80340416 TAGAAAAAGCACAAGAAAGATGG - Intergenic
1130824134 15:87526248-87526270 AAGACAAAGCATAAGATAGATGG - Intergenic
1131027186 15:89153441-89153463 AAGAAAAAGCATTAGAAATAAGG - Intronic
1131481556 15:92786573-92786595 AAGAATAAAGATAATAAAGATGG + Intronic
1131700388 15:94929198-94929220 AAGAAAAACCATTAGAAAGCAGG - Intergenic
1133101736 16:3484227-3484249 AATAATAAGCAGGAAAGAGAGGG + Intronic
1133609815 16:7422857-7422879 AAGAAAAAGCATCAGGAATATGG - Intronic
1133826786 16:9285001-9285023 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1134394946 16:13854198-13854220 AAGAAAAAGAAAGAAAAAGAGGG + Intergenic
1134867113 16:17618311-17618333 AACGATGAGAATGAGAAAGATGG + Intergenic
1134904842 16:17971529-17971551 AAGAAGAGACAGGAGAAAGATGG + Intergenic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135463647 16:22666236-22666258 AAAAATAAGCAAGAGAAAAGAGG - Intergenic
1135492859 16:22924955-22924977 CAGAATAACCATGAGAAGGGAGG + Intergenic
1136182850 16:28566283-28566305 AAGAAAAAGAAAAAGAAAGAGGG + Intronic
1137340194 16:47594356-47594378 AAGATTAAGCAAGACAAAGATGG + Intronic
1137379967 16:47988198-47988220 AGGAATACGCATAGGAAAGAAGG + Intergenic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138582083 16:57948296-57948318 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1138861850 16:60767661-60767683 GAGATAAAGAATGAGAAAGAAGG + Intergenic
1139076798 16:63461235-63461257 GAGAGTAAGCATGTGACAGAAGG + Intergenic
1139133314 16:64172049-64172071 AAGAAAAAGCAAGACAAAAAAGG + Intergenic
1139845534 16:69918620-69918642 ATGATCAAGCATCAGAAAGAAGG - Intronic
1140060577 16:71565808-71565830 AAGGACAGGAATGAGAAAGAAGG + Exonic
1140290871 16:73655319-73655341 AAATATAAGGATTAGAAAGAAGG + Intergenic
1140342487 16:74178312-74178334 CAGAATGAGAAGGAGAAAGAAGG + Intergenic
1140704667 16:77615770-77615792 AATAACGATCATGAGAAAGATGG + Intergenic
1140825679 16:78703666-78703688 AAGAATCACCATAAAAAAGATGG + Intronic
1141474419 16:84263038-84263060 AACAATAAGGCTGAGAAAGAGGG - Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1142786222 17:2225615-2225637 AAGAATATACATGACAACGATGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143711290 17:8736967-8736989 AAGAAGAAGAAAGAGAGAGAGGG + Intronic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1143794822 17:9328003-9328025 AAGAGAAAGAATGAGAGAGAAGG - Intronic
1144116197 17:12094046-12094068 AATAATCAAAATGAGAAAGAAGG + Intronic
1144217578 17:13069948-13069970 AACAAGTACCATGAGAAAGATGG - Intergenic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1145838159 17:27970545-27970567 AAGGATAAGAATAAGACAGAAGG - Intergenic
1145839357 17:27981316-27981338 AAGAAGAAGGAGGAGACAGAAGG + Intergenic
1146455448 17:33005969-33005991 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
1146812087 17:35911918-35911940 AAGAATAAGCATAAAAATGGAGG - Intergenic
1147054734 17:37825525-37825547 GAGAAAGAACATGAGAAAGAGGG + Intergenic
1147846942 17:43411124-43411146 AAGAAACAGAAAGAGAAAGAAGG - Intergenic
1148184793 17:45634343-45634365 TAAACTAAGCATGAAAAAGAAGG + Intergenic
1148232295 17:45944117-45944139 AAAAAAATGCATGAGAAAGGTGG - Intronic
1148524789 17:48321337-48321359 AATAATAATAATGAGACAGAAGG - Intronic
1148668902 17:49395485-49395507 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
1149972373 17:61231880-61231902 AAAAAAAAGAAAGAGAAAGAAGG + Intronic
1150545317 17:66151007-66151029 AACAATAAGCATAAAAAAGCTGG - Intronic
1150765495 17:67998657-67998679 AAGAAAGAGCACGTGAAAGAAGG - Intergenic
1151147471 17:72054423-72054445 AATTATAAGCAAGAGAAAAAAGG + Intergenic
1151156936 17:72131388-72131410 GAGATTGAGAATGAGAAAGAAGG - Intergenic
1152109009 17:78346975-78346997 AAGAGAAAGGAAGAGAAAGAAGG - Intergenic
1152741793 17:82021621-82021643 GAGAATGAGCGTGAGAATGACGG - Intronic
1152980510 18:271864-271886 AAGAATAAAAATGAAAAAAATGG + Intergenic
1153017273 18:595509-595531 AAAAAGAAGCACAAGAAAGACGG + Intergenic
1153215028 18:2811524-2811546 GAAAAGAAGCATGAGACAGATGG + Intergenic
1153583001 18:6594237-6594259 GAGAATGAGGAAGAGAAAGAAGG + Intergenic
1153899131 18:9600568-9600590 AATAGTAAGCATAAGAAAGCTGG + Intronic
1154070044 18:11146152-11146174 AAGAATGAGCTGGATAAAGAAGG + Intronic
1154343014 18:13520015-13520037 ATGAATACACATGAAAAAGAGGG + Intronic
1155185455 18:23383322-23383344 AAGGAAAAGGAAGAGAAAGATGG + Intronic
1155212934 18:23618863-23618885 AAGAAGAAGAGTGAGAGAGAGGG + Intronic
1155589786 18:27413630-27413652 AAGAAAGAGAAAGAGAAAGAGGG + Intergenic
1155600119 18:27535914-27535936 AAGCATAAGAATGGGAAAAAAGG + Intergenic
1155744546 18:29337243-29337265 AAAAGAAGGCATGAGAAAGATGG - Intergenic
1155793451 18:30003664-30003686 AAGGAGAAGAATGAAAAAGAAGG - Intergenic
1155890370 18:31260875-31260897 AAGTCTAAGGATGAGAATGAAGG + Intergenic
1155922155 18:31614222-31614244 AAGAAAAAGAAAGAGAAAGGTGG + Intergenic
1156622264 18:38866689-38866711 AAGAATAAGCAAGGGAGAGAGGG - Intergenic
1156690325 18:39699861-39699883 GATTATAAGCATGTGAAAGAAGG - Intergenic
1156715769 18:40008079-40008101 AAGAATAAGGATGATAAAAAGGG + Intergenic
1156753364 18:40489409-40489431 AAGATTAAACATAACAAAGAGGG + Intergenic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1157015640 18:43709412-43709434 AAGAAGAGGGATGAGAGAGAAGG + Intergenic
1157186072 18:45540941-45540963 AAGAAATAGCCTGTGAAAGAGGG + Intronic
1157355518 18:46930222-46930244 AAGAACAAGCATTTCAAAGAAGG - Intronic
1158233073 18:55280295-55280317 TATAATAAGCATGAAAAAGGAGG - Intronic
1158338961 18:56445009-56445031 AAGAATAAGGAAGAGAGAGGTGG - Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1159138576 18:64365776-64365798 AAGAGTATGGATGAGAAAGTGGG + Intergenic
1159243624 18:65776624-65776646 AAGAAAAAGAGAGAGAAAGAAGG - Intronic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1160075272 18:75668390-75668412 AAAAAAAATCATGAGAGAGAAGG - Intergenic
1160238490 18:77104880-77104902 GAGAAGAAGAAAGAGAAAGAGGG - Intronic
1160273191 18:77406767-77406789 GAGAATAAAGATGAGACAGATGG - Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1161647591 19:5463400-5463422 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1162492976 19:11005445-11005467 AACCATCAGCAGGAGAAAGAAGG - Intronic
1163170007 19:15524840-15524862 AAGAAAAAGAAAAAGAAAGAGGG + Intronic
1164252930 19:23499525-23499547 AAGAAAAAGAAAGAAAAAGAAGG - Intergenic
1164290598 19:23865592-23865614 AATAATGAGCAGGAGAAAGGGGG + Intergenic
1164491522 19:28719419-28719441 AAGGATAAGCATTTGAAGGAAGG + Intergenic
1164493086 19:28732139-28732161 AAGAAGGAGAAGGAGAAAGAAGG + Intergenic
1165333767 19:35155307-35155329 AACAAGAAGCATGAGATAAATGG - Exonic
1165339388 19:35199874-35199896 AACAATAACAATGACAAAGATGG - Intergenic
1166018025 19:39997808-39997830 AAAAATAATCATGAGACAGCAGG - Intronic
1166041202 19:40204195-40204217 AAAAATAAAAATAAGAAAGATGG + Intronic
1166175578 19:41066737-41066759 GAGAAGAAGCAAGAGACAGAGGG - Intergenic
1166327031 19:42057336-42057358 AAGAAGAAGCCTCAGAAATAGGG + Intronic
1167529291 19:50004962-50004984 AAGCAGGAGCAAGAGAAAGAGGG - Intronic
1167792787 19:51691503-51691525 GAGGAAAAGCAGGAGAAAGAGGG + Intergenic
1167867164 19:52337583-52337605 GAAAAAAAGCAGGAGAAAGAAGG + Intronic
1168187135 19:54707509-54707531 AGGGATAAGAATGAGAAAGCTGG - Intergenic
1168197059 19:54782768-54782790 CAGAAAAAGCAGGAGAAAGCTGG + Intronic
1168319842 19:55502345-55502367 AAGAAAAAAAATGAGAAAGATGG - Intronic
925607611 2:5674255-5674277 AAGAGAAAGAAAGAGAAAGAAGG - Intergenic
925697751 2:6599137-6599159 AAGAAGAAGAAAAAGAAAGAAGG + Intergenic
925890302 2:8428227-8428249 AAGAAGAAGAAAGAGAGAGAAGG + Intergenic
925943260 2:8839341-8839363 AAGAATAGAGATGAGAAGGAGGG + Intergenic
926377857 2:12251790-12251812 AAGAAAAAGCATAAGAAAATAGG + Intergenic
926489071 2:13501423-13501445 AAGAATATTCATGAGGCAGAAGG - Intergenic
929187677 2:39112338-39112360 AAGAAAGAGCAAGAGAGAGAGGG - Intronic
929283741 2:40112668-40112690 AAAAATAAGGATGGGAAGGATGG + Intronic
929348707 2:40920622-40920644 AATAATAAGGATAAGAAATATGG - Intergenic
929458051 2:42080152-42080174 AAGAAAAAGCAATGGAAAGAAGG - Intergenic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
929991694 2:46795403-46795425 AAAAAAAAACATGAGAATGATGG + Intergenic
930203296 2:48564683-48564705 AAGAAGAAGAAGAAGAAAGAAGG - Intronic
930228276 2:48816823-48816845 AAGAAAGAGAATGAGAAAGAAGG + Intergenic
930434324 2:51321137-51321159 AATAATAAGCATTAAAAAGGAGG - Intergenic
930453066 2:51568522-51568544 AAGAAGCACCATGAGAAAAAAGG - Intergenic
930587810 2:53290219-53290241 AAGAAGTAGGAGGAGAAAGAAGG - Intergenic
930654299 2:53992891-53992913 GAGAATACGCATCAGAAAAAAGG + Intronic
930720646 2:54634446-54634468 ATCAATAAGCATAATAAAGATGG + Intronic
931227458 2:60344346-60344368 AACAATAAACATGAGAAAACTGG + Intergenic
931245303 2:60487592-60487614 AAAAAAAGGCATGAAAAAGAAGG + Intronic
931266128 2:60661889-60661911 AACAATGAGCATGAGCAACAGGG - Intergenic
931299633 2:60964964-60964986 AAGGATATGCATCAGAAACATGG - Intronic
931647955 2:64442376-64442398 AGGAAGCACCATGAGAAAGAGGG - Intergenic
931675355 2:64689499-64689521 AGGAATAAGAAGAAGAAAGAGGG + Intronic
933125625 2:78601472-78601494 CAGAATCTGCATGAGAGAGAAGG - Intergenic
933234663 2:79851687-79851709 AAAAAAAAGGATGAGAAAAAGGG - Intronic
933293184 2:80460536-80460558 AAGAAGAAGCGGGAGAAAGAGGG - Intronic
933318642 2:80745095-80745117 AAGAAATATCATTAGAAAGATGG + Intergenic
933561042 2:83886486-83886508 AAGAAAAAGAATAAAAAAGATGG - Intergenic
933682077 2:85110959-85110981 GAGAACAAGCATGAGAAATAAGG + Intergenic
933803170 2:85979078-85979100 AAGAATGAGAAAGAGAAGGAAGG - Intergenic
934551721 2:95267007-95267029 AGGAATAGGCATGAGAAAGGAGG - Intergenic
935544537 2:104386910-104386932 AAAAGTCAGCATGAGAAAGCAGG - Intergenic
935570104 2:104650581-104650603 AAGAGAAAGAAAGAGAAAGAAGG + Intergenic
935711857 2:105906088-105906110 AAGGAGCAGCATGAGAAAGGAGG - Intergenic
935717553 2:105952508-105952530 AAGAAAAAGCACCAGAAAGAGGG + Intergenic
935930261 2:108116618-108116640 AAGAAGAAGCAAGAGTGAGAAGG + Intergenic
935995227 2:108763990-108764012 AACAAGAATCATGAGACAGATGG + Exonic
936846784 2:116844233-116844255 AAGAAAAAGAAAAAGAAAGAGGG - Intergenic
937530874 2:122825567-122825589 TAGAATGAGGATGGGAAAGAAGG - Intergenic
937615958 2:123922631-123922653 GAGAAAGAGCAAGAGAAAGAGGG + Intergenic
937701774 2:124870381-124870403 AAGAAAAAGAATGAGAAAAGAGG - Intronic
937719916 2:125082123-125082145 AGGAATAAGCAAGAGAAAAAGGG - Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
937985047 2:127634662-127634684 AAGAACAAGCCCCAGAAAGAAGG + Exonic
938214122 2:129493796-129493818 AAGAAAAAGAATGAAGAAGAAGG + Intergenic
938656081 2:133435573-133435595 GAGAGTAGGCAAGAGAAAGAGGG + Intronic
938688611 2:133765532-133765554 AAGAACAAGAATTAGAAAGAAGG + Intergenic
939087961 2:137744141-137744163 AAGAATAGGCATGAATATGAAGG + Intergenic
939226859 2:139375912-139375934 GAAAATATGCATGAGAATGAAGG + Intergenic
939274972 2:139989402-139989424 CAGAATATGGATGGGAAAGAAGG - Intergenic
939618557 2:144389665-144389687 GAGAAGGAGCACGAGAAAGAAGG - Exonic
940022709 2:149172160-149172182 AAGAAGAAGAATGAGCAAAAGGG + Intronic
940121222 2:150268584-150268606 AAGAATAATTATGGGAAATAAGG + Intergenic
940287793 2:152049479-152049501 AAGAATGAGAAGGAGAAATACGG - Intronic
940554772 2:155209881-155209903 AAGAAAATGGAAGAGAAAGAAGG + Intergenic
940805013 2:158177365-158177387 AAGAATTAGCATGAAGAAAATGG + Intronic
940917095 2:159267716-159267738 ATGAATACGTATGGGAAAGAGGG - Intronic
941055156 2:160778864-160778886 AAGAATAAAAAGGACAAAGAAGG + Intergenic
941201001 2:162510395-162510417 AAGAATACATATCAGAAAGAAGG + Intronic
941331119 2:164178544-164178566 AAGCAAAAGTATTAGAAAGAAGG - Intergenic
942049509 2:172126116-172126138 AACAATAAGCATGAAAAAGCTGG - Intergenic
942305382 2:174601954-174601976 AAGAAGAGGCAGAAGAAAGAGGG + Intronic
942389810 2:175480202-175480224 AAGTATAAGCAATAGAAACAAGG + Intergenic
943135876 2:183912532-183912554 AAAGAGAAGCAGGAGAAAGAAGG - Intergenic
943437212 2:187881100-187881122 AAGGATGAGGAAGAGAAAGAAGG + Intergenic
943524580 2:189000463-189000485 AAGAATGAGAAAGAGAGAGATGG + Intronic
943577592 2:189649030-189649052 AAAAAGAGGGATGAGAAAGAGGG + Intergenic
943734432 2:191339063-191339085 AAGCAGAAACATGAGAAAGCAGG + Intronic
943807613 2:192141644-192141666 AAGAGGAAGCATGAAAGAGAGGG + Intronic
944131201 2:196349219-196349241 AGGAATGAGGATGGGAAAGAAGG - Intronic
944185140 2:196939934-196939956 CAGCATCAGTATGAGAAAGAAGG - Intergenic
944478626 2:200132030-200132052 AAGAATAATCAGGGGAAAGGAGG + Intergenic
944497347 2:200321225-200321247 AAGAATCAGCATGACATAGTCGG + Intronic
944665891 2:201959201-201959223 AGGAATTAGCTTGAGAGAGAAGG - Intergenic
944702941 2:202261839-202261861 AATAACAAGGATGAGAAACATGG - Intergenic
945242260 2:207686879-207686901 AAGGAAAAGAAAGAGAAAGAAGG + Intergenic
946920490 2:224576197-224576219 AAAGATAAGCCTGAGAAATAGGG + Intronic
947321811 2:228927422-228927444 AACAATAAACATGAGAAATCAGG - Intronic
947907498 2:233775943-233775965 AAGAGGAAGTATGAGCAAGAGGG - Intronic
948020337 2:234727217-234727239 AGAAAGAAGAATGAGAAAGATGG + Intergenic
948156035 2:235782323-235782345 AATAATATACATGAGAAAGATGG - Intronic
948559583 2:238843054-238843076 AAGAAAAAAAAAGAGAAAGAAGG - Intergenic
948997928 2:241593428-241593450 ATGAATCCGCAGGAGAAAGATGG + Intronic
1168759064 20:336373-336395 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1168865397 20:1081672-1081694 AAGAATATGCAAGGGAAACAAGG + Intergenic
1169526541 20:6433146-6433168 AAGGATAAGAATGAGAACAAGGG + Intergenic
1169634875 20:7678438-7678460 AAGAGTAATCATAAGAAAGCTGG + Intergenic
1169954650 20:11087792-11087814 AAGAGAAAGCAAGAGAAAGGGGG + Intergenic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170507239 20:17039928-17039950 GGAAATAAGAATGAGAAAGATGG + Intergenic
1170683863 20:18551063-18551085 AAGAAAAAGAGAGAGAAAGATGG - Intronic
1170714382 20:18819373-18819395 AAGAATAAGAAAGAGAGAGGGGG - Intronic
1170752061 20:19158258-19158280 AAAAATAAGAATGAGAGAGAGGG - Intergenic
1171067720 20:22034963-22034985 AAGAGAAACCTTGAGAAAGAAGG + Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1171941132 20:31330978-31331000 AAGAAGAAGAAGGAGCAAGAGGG + Intergenic
1171988945 20:31680833-31680855 AAGAATAAATGTGAGAAAGGGGG + Intronic
1172414653 20:34755004-34755026 AATAATAAGGTTGGGAAAGATGG + Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174538839 20:51273785-51273807 AAGAAACAGCATCAGAAAAATGG - Intergenic
1174673816 20:52333891-52333913 AAGAAGATGCAGGAGCAAGAAGG + Intergenic
1174713576 20:52732666-52732688 AAGAAAAAGAAAGAGAAAAAGGG + Intergenic
1175142765 20:56873157-56873179 AAGAAAAAGAAAGAGAGAGAGGG + Intergenic
1175283927 20:57824483-57824505 AAGAAGAGGCAAAAGAAAGAAGG - Intergenic
1176885342 21:14248694-14248716 TACAACAAGCATGAGAAACAGGG - Intergenic
1176979198 21:15359943-15359965 AAGAACAACCTTGAAAAAGAAGG - Intergenic
1177000650 21:15608008-15608030 AAGAATAAGAAAGAGAGAAAGGG + Intergenic
1177304420 21:19294578-19294600 AAGATTAAACAAGAAAAAGAAGG + Intergenic
1177365966 21:20137203-20137225 AATAATAAGCATTATAAATATGG - Intergenic
1177563977 21:22794864-22794886 AAGAAAAAGAAAGAAAAAGAAGG + Intergenic
1177610406 21:23440039-23440061 AAAAATAAGAAAGACAAAGAAGG + Intergenic
1178198328 21:30374355-30374377 AAGAAAAAGAAAAAGAAAGAGGG - Intronic
1178428113 21:32495315-32495337 AAGAATAAGAAAGAAAAAAAGGG - Intronic
1178642411 21:34355700-34355722 AAAAAGAAGAAAGAGAAAGAAGG + Intergenic
1179065941 21:38024993-38025015 AAGATAAAGCTTGAGAAAGGAGG - Intronic
1179071256 21:38073248-38073270 AAGAAGAAGAAAGAAAAAGAAGG + Intronic
1179141380 21:38728417-38728439 AAGAATGAGAATAAGAATGAGGG - Intergenic
1179404291 21:41112483-41112505 AAAAAAAAGAAGGAGAAAGAAGG + Intergenic
1179499940 21:41801971-41801993 AAAAGTAAGCACGAAAAAGACGG + Intronic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1181563028 22:23716799-23716821 AAAATTAAACATTAGAAAGAAGG + Intergenic
1181853897 22:25768910-25768932 CAGAATAAGAAGGACAAAGAAGG + Exonic
1182230403 22:28833452-28833474 AAGAAAAAGAAAGAGAAAAAGGG + Intergenic
1182249008 22:28984728-28984750 TAGAAAAAGGATGAGCAAGAGGG - Intronic
1182259064 22:29059810-29059832 AAAAATAAGGGTGAGAAGGAAGG - Intronic
1182568401 22:31216898-31216920 TAGATAAAGGATGAGAAAGAAGG - Intronic
1182679871 22:32070285-32070307 AAGAAGAAGAATGAAGAAGAAGG - Intronic
1182828229 22:33283908-33283930 AAGGAAAAGAAAGAGAAAGAAGG + Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183036150 22:35142345-35142367 AAGAATAAGGAAAGGAAAGAGGG + Intergenic
1183081777 22:35461394-35461416 AAGAAAAAGAAAGAGAGAGAGGG - Intergenic
1183372454 22:37441552-37441574 ATGAAAATGCAGGAGAAAGAGGG - Intergenic
1184014794 22:41777892-41777914 AAGAAGATGAAGGAGAAAGAAGG - Intronic
1184312389 22:43655572-43655594 AAGAAGAAACATGAGACAGCCGG + Intronic
1184544510 22:45157548-45157570 GAGAAAAAGTATGTGAAAGAGGG + Intergenic
1184720779 22:46311819-46311841 AAGAATGATAATGAGAAAGCTGG - Intronic
1184944438 22:47793094-47793116 AAAAATAAGCATAAAAAGGAAGG + Intergenic
1185209218 22:49558703-49558725 AATATTAAGGATGAGAAAGCTGG - Intronic
949730157 3:7101409-7101431 AACAACAAGCATAAGAAAGCTGG - Intronic
949837466 3:8284826-8284848 AATAATACGCATGTGAAAGCAGG + Intergenic
949891503 3:8736984-8737006 AAGAATAAAGAAAAGAAAGAAGG + Intronic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951090249 3:18564368-18564390 AAAAATATGCATGGAAAAGATGG + Intergenic
952042703 3:29279713-29279735 AAGAATAACAATCAGAAGGAAGG - Intergenic
952585799 3:34890251-34890273 AAGAAAAAGAAAGAAAAAGAAGG - Intergenic
952652997 3:35748454-35748476 AAGAAAAAGAAAGAGAGAGAGGG + Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
952674481 3:36010774-36010796 AACAATAAACATGAGAATGCAGG - Intergenic
952875574 3:37941708-37941730 AGGGATAAGGAGGAGAAAGAGGG + Intronic
953101347 3:39831545-39831567 AAAAATAAGTATTAAAAAGAAGG - Intronic
954848687 3:53582159-53582181 AAGAACCACCAAGAGAAAGAAGG - Intronic
955100844 3:55848315-55848337 AAGAATAATTAGGAAAAAGAGGG - Intronic
955129915 3:56156171-56156193 AAGAATCACCAAAAGAAAGAGGG + Intronic
956202631 3:66722317-66722339 AAGAAGAAGAAGGAGAAAGAGGG - Intergenic
956261692 3:67350199-67350221 GAGCAGAAGCAAGAGAAAGATGG - Intergenic
956569191 3:70674907-70674929 AAGAATAAGTAGAAGAAACAGGG - Intergenic
957156893 3:76555403-76555425 AAGAAGAAGAAGAAGAAAGAAGG + Intronic
957336281 3:78833206-78833228 AAAAATAAGGATGAAAAAAAAGG + Intronic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957617279 3:82546831-82546853 TAGAAAAAGTATGAGAAAAAGGG - Intergenic
958069033 3:88585375-88585397 ATGGATAATCATGAAAAAGAAGG + Intergenic
958536774 3:95414313-95414335 AAGAAAAAGAAAGAGACAGAAGG + Intergenic
958888758 3:99759455-99759477 TAGCATAAACATGAGAAAAAGGG + Intronic
959024368 3:101223732-101223754 AAGAATAAAAAAGAGAAAGTGGG + Exonic
959362577 3:105412105-105412127 AAGTAAAACCCTGAGAAAGAAGG + Intronic
959903910 3:111689699-111689721 AAGAAGAAGGAGGGGAAAGATGG + Intronic
960190352 3:114697136-114697158 AGTAAAAAGCAAGAGAAAGATGG + Intronic
960418018 3:117409178-117409200 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
960812149 3:121635675-121635697 AAGAAAAAGAATGAGGGAGAAGG + Intronic
960812595 3:121638710-121638732 AAGAGTAAGCATAAGAAAGATGG + Intronic
960900102 3:122545677-122545699 AAGAATAAGCATAGGAAAAATGG + Intronic
960905752 3:122599472-122599494 AAGAAAAAGAAAGAGAGAGAGGG - Intronic
961038742 3:123662071-123662093 AAGGCTCAGCATGAGAAAAATGG + Intronic
961339007 3:126204910-126204932 GACAATAAGCATAATAAAGATGG + Intergenic
961905692 3:130260835-130260857 AAGAAAACACATGAAAAAGATGG + Intergenic
962518573 3:136176707-136176729 AAGAAGGAGCAAGAGAGAGAAGG - Intronic
962670620 3:137703404-137703426 AACAATAAACATCAGAAAGCTGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962941279 3:140126720-140126742 AAGAATAAAGCTGAAAAAGATGG - Intronic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
963625438 3:147666175-147666197 AAGTAGAAGCAAGATAAAGAAGG - Intergenic
963849883 3:150200665-150200687 AAGTATCTGCATCAGAAAGAAGG + Intergenic
964112822 3:153105019-153105041 AAGAATAAGAATGAGAATTAAGG + Intergenic
964528682 3:157643867-157643889 AAGAACAAGAGTGAGAGAGAGGG + Intronic
964665698 3:159169632-159169654 CAGAATAAAAATGAAAAAGAGGG + Intronic
964963605 3:162460714-162460736 AGGAAGAAGCATGAGAAAAAAGG + Intergenic
965302589 3:167020858-167020880 GAGAATAATCATTACAAAGATGG + Intergenic
965378465 3:167957148-167957170 AAGATTAAACTTGAGCAAGATGG - Intergenic
965410826 3:168328524-168328546 AAGAAAAGGAATGAGCAAGATGG + Intergenic
965734083 3:171802740-171802762 ATGAATGAGCATGAGAAATCAGG + Intronic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
966022446 3:175232102-175232124 AAGAAGGAGAAGGAGAAAGAAGG + Intronic
966075686 3:175934696-175934718 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
966239073 3:177735166-177735188 AAAAATAGGCATAAGACAGAAGG + Intergenic
966285634 3:178292340-178292362 AAGTATAAGGATGAGAAATGTGG + Intergenic
966319893 3:178690529-178690551 AGGAAGAAGGAAGAGAAAGAGGG + Intronic
966747621 3:183293173-183293195 AACACTAAGCATGAGAAAACTGG + Intronic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
967046475 3:185741923-185741945 AAGAAGTAACATGAGTAAGAGGG - Intronic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967627135 3:191699808-191699830 AAGAAAAAGAAAGAGAAAGAAGG + Intergenic
967718105 3:192787221-192787243 AAGACTACGCATGGGAAAGAGGG - Intergenic
967796000 3:193599380-193599402 AAGAATAAAAAAGAGAAAGAAGG - Intronic
967883424 3:194317288-194317310 CAGAATAATCATGAACAAGATGG - Intergenic
968433202 4:571428-571450 AAGAAAAAAAAAGAGAAAGAAGG + Intergenic
968895460 4:3399323-3399345 AAGTATAATCAAGAAAAAGAGGG + Intronic
968914165 4:3489913-3489935 ATGAATGAGCAGGAGACAGAAGG - Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969920801 4:10537780-10537802 AAGAACAAACAAGAGAAGGAAGG - Intronic
969973077 4:11068106-11068128 AAGAAAAAGGAAGGGAAAGAAGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970530086 4:16972729-16972751 AAGAATAAGCAAAATAAAAAAGG + Intergenic
970697318 4:18693529-18693551 AATAAAAAGGAAGAGAAAGAAGG - Intergenic
970740613 4:19233363-19233385 AAGAAAAAGAAAAAGAAAGAGGG + Intergenic
971056004 4:22913481-22913503 AACAATATGCATAAGAAAGCTGG - Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971428295 4:26537487-26537509 TAGAATAAGCATGGGAATGGGGG - Intergenic
971663966 4:29458071-29458093 AAGAAAAAGAAAAAGAAAGAAGG - Intergenic
971948072 4:33307017-33307039 GAGAAGAAGCAAGAGCAAGAGGG + Intergenic
971991498 4:33902455-33902477 AAAAATAATCATTAGAAGGAAGG + Intergenic
972230240 4:37063990-37064012 AAGAAGAGGCATGAGACTGATGG + Intergenic
972316344 4:37929875-37929897 AAGAAAAAGGAGGAGAAAGATGG + Intronic
972400087 4:38693354-38693376 AAAAAAAAGCATGAGAAGTAAGG + Intronic
972870523 4:43292301-43292323 AAGAAAAAGCTTGAAAAAGTGGG - Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973632646 4:52833857-52833879 GAGAAAATGCATGAGAAAGTGGG - Intergenic
973696606 4:53496611-53496633 AAGAACAAGGTGGAGAAAGATGG - Intronic
973898685 4:55443944-55443966 AAGAATGAGCATTAAAAAGAAGG + Intronic
973909712 4:55567081-55567103 ACAAATAAGGATGAGAAACACGG - Intronic
973987915 4:56373505-56373527 AAAGAGAAGCAAGAGAAAGAAGG + Intronic
974001536 4:56516324-56516346 AATAATAACCATAAGAAAGATGG + Intronic
974112438 4:57541109-57541131 AAGAATCAGCATGAGGTTGATGG + Intergenic
974330975 4:60478760-60478782 AAGCAGAAGCAAGAAAAAGACGG + Intergenic
974413520 4:61573397-61573419 AAGTTTAAGCATTTGAAAGATGG - Intronic
974637648 4:64585431-64585453 AAGGATAAGCCTGAGGGAGAAGG - Intergenic
974698505 4:65406620-65406642 AGGAAGAAGTATCAGAAAGAGGG - Intronic
975173431 4:71259525-71259547 AAGAACAAGCAGGAGAGACAAGG + Intronic
975282017 4:72571634-72571656 AGGATAAAGCATGAGAAAAAAGG - Intergenic
975481807 4:74889315-74889337 AGGATTATGCATGAGAAAGCTGG + Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
976481715 4:85554474-85554496 AAGAATAAAAACGAGAAATATGG - Intronic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
977002885 4:91525734-91525756 AAGAAGAAGCATAGGTAAGAGGG - Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977270635 4:94913611-94913633 AAGAATAAGCATGAATACAATGG - Intronic
977409151 4:96639190-96639212 GAGAATTAGCCTTAGAAAGAAGG - Intergenic
977869029 4:102067484-102067506 AAACATAAGCATAAGAAAGCTGG + Intronic
978268538 4:106858987-106859009 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
978386466 4:108180463-108180485 AAGAAGAGGGAAGAGAAAGAAGG + Intergenic
978614130 4:110576790-110576812 AAGAACAATCATTAGTAAGATGG + Intergenic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
978987877 4:115038227-115038249 AGTAATAAACATGAGAAAGCAGG - Intronic
979060100 4:116046513-116046535 AAGAAAGAGAAAGAGAAAGAAGG + Intergenic
979125207 4:116962696-116962718 GAACATAAACATGAGAAAGATGG + Intergenic
979237210 4:118414854-118414876 AAGAATAAACACTAAAAAGATGG - Intergenic
979535496 4:121815528-121815550 ACTAATAAGCAGGAGAAAAATGG + Intronic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980215335 4:129845452-129845474 AATTAAAAGCAAGAGAAAGATGG - Intergenic
980332348 4:131426193-131426215 AAGAAAAGGAAGGAGAAAGAAGG + Intergenic
980420175 4:132548485-132548507 AAAAATAAGCATGATACATATGG + Intergenic
980742568 4:136972046-136972068 AAGAAGAAGGATGAAGAAGAAGG + Intergenic
980835124 4:138182111-138182133 AAAAATAGGCATCAGAAACATGG + Intronic
981278446 4:142929283-142929305 AAGAATAAGAGTGTCAAAGAGGG - Intergenic
981536528 4:145805962-145805984 AAAAATAAGCAAGGGAAAGAGGG - Intronic
981648172 4:147023696-147023718 AAGAAGAAGGTTAAGAAAGAAGG - Intergenic
981837616 4:149073546-149073568 AGGGAGAAGAATGAGAAAGACGG - Intergenic
982349971 4:154404834-154404856 GACAATAAGCATGATAAAGCTGG - Intronic
982635397 4:157889391-157889413 AAGAAGAACCATCAGAAAGTAGG + Intergenic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
982929604 4:161386615-161386637 AAGAATGACCTAGAGAAAGAAGG - Intronic
982989303 4:162250535-162250557 AACAATAAACATGAGAAGGCTGG + Intergenic
983365486 4:166781562-166781584 AAGAAGAAGAAAGAGAAAAATGG + Intronic
983591776 4:169421030-169421052 AAGATTAAGCATAAGAGAGCTGG + Intronic
984038142 4:174693970-174693992 AAGATAAAACATGACAAAGAAGG + Intronic
984510617 4:180674144-180674166 AAGATTTAGCATGAAAAAGTAGG + Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
984608474 4:181811625-181811647 AAGACAAAGCATGAGCAAAAGGG + Intergenic
984994715 4:185418461-185418483 AAGAAAATTCATGAGAAAGAAGG - Exonic
985137033 4:186796310-186796332 AAGTACATGGATGAGAAAGAGGG - Intergenic
985210099 4:187583462-187583484 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
985492088 5:186060-186082 AATAAAAAGCAGGAGCAAGATGG - Exonic
985519553 5:367094-367116 AAGCATAAGCAGGAGGAACAAGG + Intronic
985645095 5:1081158-1081180 AAGACAAAGGAAGAGAAAGAAGG + Intronic
985787307 5:1903938-1903960 AAGGATAAGATTGAGCAAGAGGG + Intergenic
986175167 5:5346250-5346272 AAGAATCAGCATCAGAACCAGGG - Intergenic
986588300 5:9342121-9342143 AAGAAAAAGAAAGGGAAAGAGGG + Intronic
986628754 5:9748602-9748624 GAGAGTAAGCAAGAGAAAGAGGG + Intergenic
986918651 5:12658839-12658861 AAGAATAAGTGTGAGAAATATGG - Intergenic
987001539 5:13664848-13664870 AAGAAGGAGGATGAGAAGGAGGG + Intergenic
987911019 5:24145655-24145677 AAGGAAAAGAAAGAGAAAGAAGG + Intronic
987940395 5:24528271-24528293 ATGCTTCAGCATGAGAAAGAAGG - Intronic
987998908 5:25324315-25324337 AATAATAAACATGAAAACGATGG + Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988257257 5:28836576-28836598 AAGAGCAAGCAAGAGAGAGAGGG + Intergenic
988268526 5:28983895-28983917 AAAAATAAACATCAGAAAGTGGG - Intergenic
988297280 5:29381953-29381975 AAGAAAAAGCCTGAAAAAGAAGG + Intergenic
988358817 5:30209909-30209931 AAGAAGAAGGAAGAGAAAAAAGG + Intergenic
988493762 5:31727242-31727264 AAGAATAGGCATGAGCTTGATGG + Intronic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988645115 5:33086371-33086393 AAGAAAAAGTACGAGAAATAAGG + Intergenic
989466109 5:41757739-41757761 AGGAATAAGCCAGATAAAGAGGG + Intronic
989575735 5:42986483-42986505 AAGAAGGAGCAAGAGAGAGAGGG - Intergenic
989658996 5:43778548-43778570 AAAAATATGCATGAAAAACATGG + Intergenic
989734547 5:44688310-44688332 AAGAAAAAGAAAGAAAAAGAAGG + Intergenic
989981911 5:50655611-50655633 AAGGAAAAGAAAGAGAAAGACGG - Intergenic
990013704 5:51031532-51031554 CAGAAAAAGTAAGAGAAAGAAGG + Intergenic
990604010 5:57389359-57389381 GAAAATAAGCATATGAAAGATGG - Intergenic
990722944 5:58718526-58718548 TAGAATAAGCCTGAGGCAGAAGG - Intronic
991027825 5:62050113-62050135 AAGATTAAGAAAGACAAAGAAGG - Intergenic
991337633 5:65566717-65566739 GAGAAGAAGGAAGAGAAAGAAGG - Intronic
992073795 5:73172938-73172960 AAGAAAAAGAAAGAGAAAGATGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992135183 5:73737302-73737324 TAGGAAAAGCGTGAGAAAGATGG - Intronic
992331268 5:75719229-75719251 TATAATAAGCATGAAAAAAAAGG - Intergenic
992709634 5:79438094-79438116 AAAAATTCTCATGAGAAAGAGGG + Intronic
992864410 5:80942920-80942942 AAGCATGAGCATGATGAAGAGGG + Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993101762 5:83549083-83549105 AAGTAAAAACATTAGAAAGATGG + Intronic
993148258 5:84125100-84125122 AATAATGAGAATGAGACAGAGGG + Intronic
993162289 5:84307840-84307862 AAGAATATGAATTAGAAGGAGGG + Intronic
993219885 5:85079461-85079483 GAGAATATAAATGAGAAAGAAGG - Intergenic
993226835 5:85177033-85177055 AAAGAGAAGCTTGAGAAAGAAGG + Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993337380 5:86677798-86677820 AAGAAAAAGCAAAACAAAGAAGG - Intergenic
993453398 5:88099600-88099622 AAGGATAAGCATGGCAGAGATGG - Intergenic
993543931 5:89187536-89187558 ATGAAGAAGAATGAGATAGAGGG - Intergenic
993573698 5:89575121-89575143 ATGAATAAGCATTATACAGAAGG + Intergenic
993754722 5:91714324-91714346 AAGTAGAAGCAAGAGAAAGGTGG + Intergenic
994247148 5:97490673-97490695 AAGAAAATTCATGAGAGAGAGGG - Intergenic
994575494 5:101573956-101573978 AAGAGCAAAAATGAGAAAGAAGG + Intergenic
994769911 5:103967763-103967785 AAGAAGAAGCAAGAGAGAAAGGG - Intergenic
994930031 5:106170628-106170650 GAGCACAAGCGTGAGAAAGATGG + Intergenic
995348867 5:111152166-111152188 AAGAAAACGAAAGAGAAAGAAGG - Intergenic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995892128 5:116966530-116966552 GAGAGTAGGCAGGAGAAAGATGG - Intergenic
996259924 5:121454432-121454454 GAGAATAATAATGAGAAAGTTGG - Intergenic
996418308 5:123233927-123233949 AAGAAAAATAAAGAGAAAGAAGG - Intergenic
996468204 5:123827607-123827629 AAGAATAAAAAAGAGAAAGAAGG + Intergenic
996887188 5:128371415-128371437 AAGAAAAAGAGAGAGAAAGAAGG - Intronic
997030447 5:130121299-130121321 AAATGGAAGCATGAGAAAGAAGG + Intronic
997410855 5:133689673-133689695 AACAATAAGCTTGAAAAAGTAGG - Intergenic
997465694 5:134086656-134086678 AAGAAGAAGGAAGAAAAAGAAGG - Intergenic
998346978 5:141473000-141473022 AAGAAAAAGAAAAAGAAAGAAGG + Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998443827 5:142183594-142183616 AAGAACAGGCAGGAGAAAGTGGG - Intergenic
998520803 5:142798755-142798777 AAGGAGAAGCATGGGGAAGAGGG - Intronic
998684519 5:144508551-144508573 AAGAGAGAGCAGGAGAAAGAGGG + Intergenic
999184336 5:149694464-149694486 TAGAATAAAAGTGAGAAAGAGGG + Intergenic
999700828 5:154226348-154226370 AAGAATAAGCTTCAGGCAGAAGG - Intronic
1000127647 5:158262330-158262352 ATAAAAGAGCATGAGAAAGAGGG - Intergenic
1000497161 5:161999050-161999072 AAGAGCAAGCAAGTGAAAGATGG - Intergenic
1000571710 5:162923341-162923363 AAAAATAACCATCATAAAGATGG - Intergenic
1000588722 5:163132086-163132108 AAAAAAAAGAATGAGAAAGGGGG - Intergenic
1001001939 5:168015739-168015761 AGGAATGAGGATGAGAAAAACGG - Intronic
1001294727 5:170490966-170490988 AGGGATCAGCCTGAGAAAGAAGG - Intronic
1001559924 5:172662398-172662420 AATAAAAAGCATGAAAGAGATGG + Intronic
1002390196 5:178905186-178905208 AAGAATAAACATCGTAAAGATGG - Intronic
1003144285 6:3496581-3496603 AAAAGAAAGAATGAGAAAGAAGG - Intergenic
1003295835 6:4827118-4827140 AATAGTAAGCAAGAGAAAGCTGG - Intronic
1003880127 6:10472755-10472777 CAAAATAAGCTTGAGAAAGAAGG + Intergenic
1003953713 6:11142882-11142904 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1003957054 6:11173846-11173868 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1004052623 6:12101923-12101945 AATAACAAGCATAAGAAAGCTGG + Intronic
1004087645 6:12466873-12466895 AAGAATGGGGAAGAGAAAGATGG - Intergenic
1004448048 6:15719809-15719831 AAGAAAAAATATGAAAAAGAAGG - Intergenic
1004605568 6:17192030-17192052 AAGAATAAGCTTCAGGCAGATGG - Intergenic
1004813923 6:19291697-19291719 AAGAATCAGCATAATACAGAAGG - Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004997352 6:21206261-21206283 AATAATAAGTAAGAGAGAGAGGG + Intronic
1005222429 6:23601905-23601927 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1005310381 6:24553478-24553500 AATAAAAAGCAGGTGAAAGAAGG - Intronic
1005360927 6:25030081-25030103 AAGAACAAGGATGGGAGAGAGGG - Intronic
1005608504 6:27500197-27500219 AAGAGAAAGAAAGAGAAAGAAGG + Intergenic
1006027401 6:31156205-31156227 AAGAAGCAGCATGATGAAGAAGG - Intronic
1006932052 6:37694480-37694502 AAGAAACAGCATGAGAGTGAAGG - Intronic
1007630983 6:43273493-43273515 AGGAGTTAGCATGAGAAAGCAGG + Intronic
1007675470 6:43590427-43590449 AAGAATTTGCATAAGAATGAGGG + Intronic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008232698 6:49003718-49003740 AAGAAAAAAGATGAGAAACATGG + Intergenic
1008328678 6:50218904-50218926 AAGAATAAGAAAGAGAAGAAAGG - Intergenic
1008384547 6:50873621-50873643 CAGAAAAGGCAAGAGAAAGACGG + Intergenic
1008508350 6:52253098-52253120 AAGATTTAGAATGAGAAAGTTGG + Intergenic
1008895559 6:56550508-56550530 AAGAAAAAGCAAGAGATAGGAGG - Intronic
1008938000 6:57013290-57013312 TAGAATCAGCCTAAGAAAGAGGG + Intronic
1009458152 6:63880700-63880722 AAGAAAAAGAAAGAGAAAGGGGG - Intronic
1009649795 6:66460910-66460932 AAGAATATGAATGATAAAAAAGG + Intergenic
1009652544 6:66494342-66494364 AAAAATAAACATCAAAAAGAGGG + Intergenic
1010077645 6:71819064-71819086 ATAAACAAGCATGTGAAAGAAGG + Intergenic
1010099350 6:72085591-72085613 AAGAATAAACTTGAAAATGAAGG - Intronic
1010134368 6:72532930-72532952 AAGAGAAAGAAAGAGAAAGAAGG + Intergenic
1010140901 6:72613486-72613508 AAGATTAAAAATGAGAAAGAAGG - Intergenic
1010534444 6:77010882-77010904 AAGAAAAAGAATGAAAAATATGG + Intergenic
1010565344 6:77404904-77404926 AAGAAAAAGCGAGAGACAGAGGG - Intergenic
1011383759 6:86771245-86771267 AACAATAAGCATTAGGGAGAGGG + Intergenic
1011543687 6:88461762-88461784 AAGAATAAAAAGGACAAAGAGGG + Intergenic
1011909226 6:92414410-92414432 ATGAACAAGCAAGAGAAATATGG + Intergenic
1012092918 6:94921785-94921807 AAGAAGAAGATTGAAAAAGAAGG - Intergenic
1012386250 6:98686712-98686734 AGGAATAAGCATGTAAAACAGGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013730918 6:113165849-113165871 AGGAATATGTATGAAAAAGAGGG + Intergenic
1014121568 6:117731276-117731298 AAAAATAAACATGAGAAATATGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015068689 6:129062308-129062330 CATAATAAGCTTTAGAAAGAAGG - Intronic
1015204614 6:130621217-130621239 AATAATAAGCTAGTGAAAGAAGG - Intergenic
1015850781 6:137569332-137569354 AAAAGAAAGCAAGAGAAAGAAGG - Intergenic
1015955699 6:138595910-138595932 AATAATAAGGAGGAGAAAGTCGG - Intronic
1016104040 6:140139816-140139838 AGGGAAAAGCTTGAGAAAGAAGG + Intergenic
1016359473 6:143252090-143252112 ATGAAAAAGCAAGAGAAAAATGG - Intronic
1016783742 6:147988156-147988178 AAGAGTAAGCAGGAAACAGAGGG + Intergenic
1016835522 6:148472886-148472908 AAAAGTATGAATGAGAAAGATGG + Intronic
1016852721 6:148637651-148637673 AAGAATAAGAAAGGAAAAGAAGG + Intergenic
1017247116 6:152238703-152238725 AAGAGGAAGAATGAGAAAGCAGG + Intronic
1017289925 6:152724079-152724101 AGGAAAAAGTAAGAGAAAGAGGG + Exonic
1017674076 6:156795753-156795775 AATAATAAGGAAGAGAAGGAAGG - Intronic
1018441326 6:163816127-163816149 AAGACAAGGCATCAGAAAGAAGG - Intergenic
1018654147 6:166017346-166017368 AACAGTAAGCATAAGAAAGCTGG + Intergenic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1019959300 7:4445280-4445302 AAGAGAGGGCATGAGAAAGATGG + Intergenic
1020362501 7:7343633-7343655 AAGAATAAGCATAACAAAGCTGG - Intergenic
1020540172 7:9452854-9452876 AATAATAAGAATCAGAAAGGGGG + Intergenic
1020765692 7:12317315-12317337 TAGAGCAAGCAAGAGAAAGAGGG + Intergenic
1021042422 7:15878769-15878791 AAGAATACGCTTTAGAAAGATGG + Intergenic
1021267792 7:18546536-18546558 GAGAATGAGAAGGAGAAAGAAGG - Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021879325 7:25078318-25078340 AAGGATTGGGATGAGAAAGAGGG + Intergenic
1022054693 7:26718263-26718285 AAATAAAAGCATGAGAAAGGAGG + Intronic
1022065287 7:26849203-26849225 AAGAAACAGCATGAGTGAGAAGG + Intronic
1022151828 7:27616153-27616175 AAGAGGAAGCAAGAGAAAGAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022749235 7:33205929-33205951 AACAATAATCATTATAAAGATGG - Intronic
1022971198 7:35518888-35518910 AAAAATATTCAGGAGAAAGAGGG + Intergenic
1023128861 7:36982770-36982792 AACAATAAAAAAGAGAAAGAAGG - Intronic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023355752 7:39365756-39365778 AAGAGTGAGAATGAGAAAGGAGG + Intronic
1023431642 7:40098634-40098656 AAAAATAAGGCTTAGAAAGAGGG + Intergenic
1024318392 7:48042522-48042544 AAAAATAATAATGAGAGAGAGGG + Intronic
1024471129 7:49769719-49769741 AAGAAGAAGGATGAAAGAGAGGG - Intergenic
1024616274 7:51116025-51116047 AACAGTAAGCATGAGAAAACTGG - Intronic
1024626048 7:51209210-51209232 TAGCATTGGCATGAGAAAGAGGG - Intronic
1024720231 7:52128591-52128613 GAGATTGAGGATGAGAAAGAGGG + Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1025091441 7:56067522-56067544 AAAAATAAGTATGAAAAATAGGG - Intronic
1025171670 7:56763829-56763851 ATGAAGAATCATGAGAGAGAGGG + Intergenic
1025700195 7:63811719-63811741 ATGAAGAATCATGAGAGAGAGGG - Intergenic
1025716020 7:63956332-63956354 AAGCACAAGCAGCAGAAAGAAGG - Intergenic
1025758285 7:64366833-64366855 AAGAAGAAGAAGAAGAAAGAAGG + Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026151493 7:67791473-67791495 AACAAAAAGGATCAGAAAGATGG - Intergenic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1027294664 7:76756521-76756543 AACAATAAGGCTGAGTAAGAGGG + Intergenic
1027486300 7:78765837-78765859 AAGAAAAAGCATGAGAAGCCTGG + Intronic
1027735123 7:81922337-81922359 AAGAGGAATCATAAGAAAGAGGG - Intergenic
1027914668 7:84300558-84300580 AATAATAAGCATGAGAATGCTGG + Intronic
1027960256 7:84937223-84937245 AAGAAGAAGCAATAGGAAGAAGG + Intergenic
1027971734 7:85091506-85091528 AAAAAAAAGAGTGAGAAAGAGGG + Intronic
1028429303 7:90729022-90729044 AAAAAAAATCATGAGAAAGTTGG - Intronic
1028616455 7:92773352-92773374 AAGAAATGGCATGAGAAGGAAGG + Intronic
1028808084 7:95052275-95052297 AAAAGCAAGAATGAGAAAGAAGG + Intronic
1029087027 7:98019788-98019810 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1030364408 7:108629230-108629252 AAGAAAGAGCATGAGAGAGGTGG - Intergenic
1030583072 7:111384155-111384177 AAGAAGAAGGAGGAGAAAGGAGG + Intronic
1031554410 7:123154655-123154677 AAAAATAAGCAAGTAAAAGAAGG - Intronic
1031719548 7:125154497-125154519 ACGAATAAAAATGAGACAGATGG + Intergenic
1031869437 7:127076075-127076097 AAGAAGAAACTTGAGAAAGGTGG + Intronic
1032103615 7:129005232-129005254 AAGTATAATAATGAGAAAGATGG + Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032485929 7:132287580-132287602 AAGTATAAGCATGTGCAGGATGG - Intronic
1032591658 7:133197539-133197561 AAGAAGTAACAGGAGAAAGAGGG - Intergenic
1032768716 7:135025821-135025843 AACAATAATCAAGAAAAAGAAGG + Intronic
1032884739 7:136125140-136125162 AAGAAGAAGAAGAAGAAAGAAGG - Intergenic
1032987036 7:137349002-137349024 AAGAAAAAAAATGAGAAGGAGGG + Intergenic
1033014702 7:137660811-137660833 AAAAATAAAGATGAAAAAGAGGG + Intronic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1034070455 7:148179694-148179716 AAGAAAAGGGAGGAGAAAGAGGG + Intronic
1035021311 7:155802768-155802790 AAGAATAAGAATAATAAAGTAGG - Exonic
1035938023 8:3864407-3864429 GAGAAAAAGCATGAGAAGAAAGG + Intronic
1036560956 8:9900090-9900112 AATAACAAGAATGAGAATGATGG - Intergenic
1036668063 8:10760830-10760852 AGGAATAAGCCAGACAAAGATGG - Intronic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037198543 8:16221950-16221972 AAGATTAAGAAAGACAAAGAAGG - Intronic
1037253047 8:16919498-16919520 AAAAATATGCAGGAGAGAGAGGG + Intergenic
1037411127 8:18598818-18598840 AAGAATAAACATGATCAAGAAGG + Intronic
1037773360 8:21816279-21816301 AAGAAAAATGATGAGAAAGTTGG - Intergenic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038181124 8:25228735-25228757 AAGAATAAACATGTGAAAAAAGG - Intronic
1038212824 8:25535754-25535776 AAGAAAAAGCCTGGGTAAGAAGG - Intergenic
1038701708 8:29855241-29855263 GAGAGTAAGCAAGAGAGAGATGG - Intergenic
1038884031 8:31643129-31643151 AAGAATGAGAATGAGAATGGGGG + Intronic
1038888036 8:31687700-31687722 AAGAATCAGGATCAGACAGATGG + Intronic
1039081721 8:33740155-33740177 AAGAAGGAGCAAGAGAGAGAAGG + Intergenic
1039157818 8:34581589-34581611 AAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1039711937 8:40063591-40063613 AACAATAAGAAAGACAAAGAAGG + Intergenic
1039845480 8:41322536-41322558 AAGGATAAGAAAGAGAAAGGAGG + Intergenic
1039922465 8:41903310-41903332 AAAAAAAAGAATGAGAGAGAAGG + Intergenic
1040461503 8:47653337-47653359 ATGAATAGGCATGGGAAAGTAGG + Intronic
1040599006 8:48866033-48866055 AAGAATATGTAAGAGAAGGAAGG + Intergenic
1040620071 8:49082113-49082135 AAGAAAAAGAAAGAGAGAGAAGG + Intergenic
1040925455 8:52677414-52677436 AGGAAAAAGCGAGAGAAAGAGGG + Intronic
1040980287 8:53240058-53240080 AACATTTAGCATGAGAAACAGGG + Intronic
1041145346 8:54870246-54870268 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1041221244 8:55653542-55653564 AAAAAGAAACATGAGAAATATGG + Intergenic
1041231866 8:55760415-55760437 AAGAAAAAGCGTGAAAAAGAAGG + Intronic
1041317519 8:56579780-56579802 AAGAATGAGGAGGAGAAAGAAGG + Intergenic
1041419963 8:57655714-57655736 ATGAATAAGTTTCAGAAAGATGG - Intergenic
1041644661 8:60239019-60239041 AAGAAAAAGGAAGAGAAAGAGGG + Intronic
1042068298 8:64902849-64902871 TAGAATAAAAAGGAGAAAGAAGG + Intergenic
1042219504 8:66459796-66459818 GAAAATAAGCATGATAAAAATGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042839874 8:73112730-73112752 AAGAAAGAGAAAGAGAAAGAGGG - Intronic
1042941692 8:74114692-74114714 AAAAATATTCATTAGAAAGATGG - Intergenic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1043586413 8:81774919-81774941 AAGGGTCAGCATGAGAGAGATGG + Intergenic
1044191429 8:89323119-89323141 AAGAACAAGAATGAAAAAGAGGG + Intergenic
1044398819 8:91745583-91745605 AAGAAAAAGAAGGAGACAGATGG - Intergenic
1044561896 8:93620328-93620350 AAGAAAAAGCAAGAAAAATAAGG + Intergenic
1044563945 8:93643085-93643107 AAAAATGTCCATGAGAAAGAGGG - Intergenic
1044648426 8:94468984-94469006 GAGAATAAGCCTGAGAAAACAGG + Intronic
1044983514 8:97738350-97738372 AAGAAAAAGAAAGAGAGAGACGG + Intergenic
1045074426 8:98547517-98547539 AATAAGAAGCACTAGAAAGAAGG - Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1045573799 8:103397093-103397115 AAGGAAAAGGAAGAGAAAGATGG - Intergenic
1045642363 8:104265397-104265419 AACAGTAAGCATAAGAAGGATGG - Intergenic
1045681607 8:104666795-104666817 GGGAATAATCATGGGAAAGAGGG - Intronic
1045804467 8:106141356-106141378 AAGAATAAACAAGAGCAAGAGGG - Intergenic
1046141317 8:110096676-110096698 AAGAAGAAGAATCAGAAGGAGGG + Intergenic
1046319030 8:112546392-112546414 AATAATAAGGATGAGAACAAAGG + Intronic
1046509331 8:115180052-115180074 AACAATAATCACAAGAAAGAAGG + Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046855744 8:119029772-119029794 AAGAATAAGTATAAGACAAATGG + Intronic
1046966833 8:120176866-120176888 GAGAATAAGGAGGAGAAAGTGGG - Intronic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047063888 8:121258857-121258879 AAGAAAAAGAAGGAGAATGATGG + Intergenic
1047365458 8:124207129-124207151 AAGTAAAACCATGAGTAAGAGGG + Intergenic
1048042675 8:130746336-130746358 AAGAGTTAGAAAGAGAAAGAGGG - Intergenic
1048096574 8:131301662-131301684 TAGAAAAAGCAAGAGCAAGAGGG + Intergenic
1048271735 8:133033837-133033859 AATAATAAGCATGTAAAATAAGG - Intronic
1048296090 8:133215062-133215084 AAGAAGAAAAATTAGAAAGATGG - Intronic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048667313 8:136677214-136677236 TAAAATAAGAATTAGAAAGAAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048865237 8:138755888-138755910 AAGAATAAGCCTCAGAGGGATGG - Intronic
1049013775 8:139905753-139905775 AATAATAAGAATGATAAATAGGG + Intronic
1049116854 8:140696191-140696213 AAGTGTAAGCATCACAAAGATGG - Intronic
1049459644 8:142719567-142719589 AAGATTGATCATGAGTAAGAAGG + Intergenic
1049955448 9:688817-688839 GAGAATAAGCCTGAGACAAAAGG - Intronic
1050131688 9:2419457-2419479 AGGAAAAAGGATGGGAAAGATGG + Intergenic
1050180028 9:2912210-2912232 AAGAATAAGGATGAGAATAAGGG + Intergenic
1050402988 9:5276173-5276195 AAGAAGAAGCAAGAGAGAGAGGG - Intergenic
1050644931 9:7709083-7709105 AAGAAAAATCAAGAAAAAGAGGG + Intergenic
1050681303 9:8114869-8114891 AAGAATTAGCAAGAGAACCATGG + Intergenic
1051550352 9:18321133-18321155 ACAAGTAAGCATGAGAAAGTTGG + Intergenic
1051874549 9:21777695-21777717 AAGAAAAACAATGAGAAATAAGG + Intergenic
1052361882 9:27570899-27570921 AAGAATAAGAAAGAAAATGAAGG + Intronic
1052888760 9:33676671-33676693 AAGAAAAAGGAGGAGAGAGATGG + Intergenic
1053016955 9:34667317-34667339 AAGAATGAGAGGGAGAAAGAGGG - Intergenic
1053171071 9:35884776-35884798 AAAAAAAAGCAAGACAAAGATGG - Intergenic
1053183855 9:35997678-35997700 AACAAAAAGGATGAGTAAGAGGG - Intergenic
1053336639 9:37279776-37279798 AAAAATAAGCATGTGAAAGCTGG + Intronic
1053542689 9:38991458-38991480 AAGATTAAGAAAGACAAAGAAGG - Intergenic
1053807140 9:41814977-41814999 AAGATTAAGAAAGACAAAGAAGG - Intergenic
1054623452 9:67372450-67372472 AAGATTAAGAAAGACAAAGAAGG + Intergenic
1055092839 9:72380221-72380243 AAGGTTAAGAAAGAGAAAGAGGG - Intergenic
1055262469 9:74453773-74453795 AAAAATTGACATGAGAAAGAAGG - Intergenic
1055684648 9:78758316-78758338 GAAAGTAAGCAAGAGAAAGAAGG - Intergenic
1055688688 9:78806900-78806922 AAGATGAAGCAGGAGTAAGAAGG + Intergenic
1056042644 9:82684503-82684525 AAAAAAAAGGATTAGAAAGAAGG + Intergenic
1056645321 9:88406748-88406770 AAAAATAAGCATCTAAAAGAAGG - Intronic
1057170483 9:92960473-92960495 CAGAATAACCATGGGTAAGATGG + Intronic
1058139283 9:101340904-101340926 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1058232330 9:102443168-102443190 AAGAAAAAGAATTAGAAATATGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058838702 9:108884109-108884131 AAGACTAACCAAGAGAAAGCTGG + Intronic
1058843166 9:108930724-108930746 CAGAATTTGCATGACAAAGAGGG + Intronic
1059054232 9:110962031-110962053 AAGAAAAGGCAGGAGAAACAAGG - Intronic
1059077435 9:111208948-111208970 AATAATAACAATGAGAAAAAAGG - Intergenic
1059562857 9:115352000-115352022 AATAATAAGGGGGAGAAAGAAGG + Intronic
1059739704 9:117137668-117137690 AAGAATCTTCAAGAGAAAGAGGG + Intronic
1059870824 9:118573041-118573063 GAAAATAAGGATCAGAAAGAAGG - Intergenic
1060033362 9:120234349-120234371 AAGATTAAACATGAGCAAAAAGG + Intergenic
1060332373 9:122684701-122684723 AAGAAAAAGAATAAGAAAGAAGG + Intergenic
1060366976 9:123026791-123026813 AAAAATAACCATCAGAAAGAAGG - Intronic
1060486387 9:124050014-124050036 AAGTATAAGAATTAGAAAGGAGG - Intergenic
1060674085 9:125496649-125496671 ATAAATAAGCATCACAAAGAGGG + Intronic
1061617359 9:131789139-131789161 GAGAAAAAGAAAGAGAAAGAAGG - Intergenic
1061769596 9:132908100-132908122 AATAATAATAATGAGAAAGTTGG + Intronic
1062132413 9:134905961-134905983 AAGAAGAAGAAGGAGAAAGAGGG - Intronic
1185562540 X:1070765-1070787 AAGAAAAAGAAAGAGAGAGATGG + Intergenic
1185766829 X:2732442-2732464 GAGAAGAAGAAAGAGAAAGAAGG - Intronic
1186081927 X:5942719-5942741 AAGGAAAAGCATGAGAATAATGG + Intronic
1186228882 X:7430929-7430951 AAGACCAAGCATGGGAAAGAAGG - Intergenic
1186480275 X:9891288-9891310 AAGACAAGGCATGAGCAAGAAGG + Intronic
1186879448 X:13850295-13850317 GAGAGGAAGCAAGAGAAAGAGGG - Intronic
1187025681 X:15433646-15433668 AAGAAGAGGAAGGAGAAAGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187077626 X:15951418-15951440 AAGAATAACCACGAAAGAGAAGG - Intergenic
1188795877 X:34463846-34463868 CAAAATTAGCCTGAGAAAGAGGG - Intergenic
1189177774 X:38975144-38975166 AAGGTTAAGCGTGAAAAAGAAGG + Intergenic
1189245839 X:39562692-39562714 GAGAAGAAGCAAGAGAGAGAAGG + Intergenic
1189439550 X:41022508-41022530 AAAAAAAGGAATGAGAAAGATGG + Intergenic
1189675137 X:43453636-43453658 AAGAATGAGCATGAGAGTGAAGG + Intergenic
1189692762 X:43634320-43634342 AAGGAAAAGCATGGTAAAGAAGG + Intergenic
1190211333 X:48450965-48450987 AAGAAAAAGGAAGAAAAAGAAGG + Intergenic
1190474850 X:50815689-50815711 AACAATAAACATGATCAAGACGG - Intergenic
1190898466 X:54644734-54644756 AAGAATAAGTATGTGAAAACAGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191752513 X:64558315-64558337 AAGAATATGCATTAGAGAAAAGG + Intergenic
1191787167 X:64928622-64928644 AAGAAGAAGAAGGAGAAAGCAGG - Intronic
1192034914 X:67551865-67551887 AAGAATTGCCATGAGAGAGAGGG - Intronic
1192064422 X:67865614-67865636 AAGAATGAGAAAGAGAGAGAGGG - Intergenic
1192096006 X:68211628-68211650 AAGAACCAGCATGACAAAGAAGG + Intronic
1192115056 X:68402156-68402178 AAGAAGGAGCAAGAGAAAGGTGG + Intronic
1192612586 X:72582280-72582302 AAAAAGAAGTATGAGGAAGAGGG + Intronic
1192887953 X:75357140-75357162 AAAAATAAAAATGAAAAAGAAGG - Intergenic
1193108369 X:77703757-77703779 GAGAGTAAGCAAGATAAAGAGGG + Intronic
1193336205 X:80292656-80292678 AAGAAAAAGCCCAAGAAAGATGG - Intergenic
1194414981 X:93601077-93601099 AAGAGAAAGCAAGAGAGAGAGGG - Intergenic
1194532135 X:95063299-95063321 AAGAATAAGCAAGTCAGAGAAGG + Intergenic
1194559068 X:95397693-95397715 GAGAAGGAGCAAGAGAAAGAGGG - Intergenic
1195386471 X:104318175-104318197 GAGAACAAGCAAGAGAGAGAAGG + Intergenic
1195450156 X:105002309-105002331 AAAGATAAGCCTGACAAAGAAGG + Intronic
1195905095 X:109836650-109836672 AAGAAAAAGAAAAAGAAAGATGG + Intergenic
1196337978 X:114561319-114561341 AACAATAATCAAGAGAAAGCAGG + Intergenic
1196942489 X:120791089-120791111 AAGAAGAAGAAAAAGAAAGAAGG - Intergenic
1197037607 X:121895359-121895381 AATAAAAAGCAGGAAAAAGAAGG + Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197164422 X:123360914-123360936 AAGACGAAGCATAAGAAAAAAGG - Intronic
1197292798 X:124680639-124680661 AAGAATAAGCAGCATAATGATGG + Intronic
1197810061 X:130433311-130433333 AAGAGTAAACATGATAGAGAGGG - Intergenic
1198015702 X:132608368-132608390 AAGAGAAAGAAAGAGAAAGAAGG + Intergenic
1198171049 X:134105551-134105573 GGGAAAAAGCAAGAGAAAGATGG + Intergenic
1198210950 X:134515503-134515525 AAGAAAAAGAAAGAGAAAAAGGG + Intronic
1198250363 X:134874193-134874215 AAGAAGAAGAATGAGCAAAAGGG + Intergenic
1198604919 X:138326465-138326487 AGTAATAAGCAAAAGAAAGATGG - Intergenic
1198683686 X:139206053-139206075 AAGAAAAAGAAAGAGAAAGAAGG + Intronic
1198721835 X:139630656-139630678 AAGAACAAGTATGAGGAAAATGG + Intronic
1198993743 X:142548293-142548315 AAGAATAAGGATCAGTAAGGAGG + Intergenic
1199167598 X:144695787-144695809 AATAAAAAGCTTGAAAAAGAAGG + Intergenic
1199658520 X:150022838-150022860 ATGAACAAGGATGAGAAAGGGGG - Intergenic
1199717863 X:150519052-150519074 AAGAAGGAGGAGGAGAAAGAAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201676373 Y:16589820-16589842 AAGAATAAGTATCATAAAAATGG - Intergenic
1202301286 Y:23417496-23417518 AAGAAAATGAAAGAGAAAGATGG + Intergenic
1202569525 Y:26253102-26253124 AAGAAAATGAAAGAGAAAGATGG - Intergenic
1202582058 Y:26392497-26392519 AAGGATAAGAATTAGAAAAATGG + Intergenic