ID: 998362835

View in Genome Browser
Species Human (GRCh38)
Location 5:141604750-141604772
Sequence TTAGTTAAGCGGTTGTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998362835 Original CRISPR TTAGTTAAGCGGTTGTCAGT AGG (reversed) Intronic
907343430 1:53754078-53754100 CAAGTTAAGAGGTTTTCAGTTGG + Intergenic
914375178 1:147066751-147066773 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
916836008 1:168545715-168545737 TTAGCAAAGAGGTTCTCAGTAGG - Intergenic
916838459 1:168574859-168574881 TTAGTAAAGAGGTTCTCAGTAGG + Intergenic
917429206 1:174948052-174948074 TTAGTTCAGTGGTTTTCAGATGG + Intronic
919254899 1:195108490-195108512 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
1066784913 10:38992907-38992929 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1066992510 10:42529505-42529527 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1067152401 10:43747657-43747679 TGTGTTAAGGGATTGTCAGTGGG + Intergenic
1068150604 10:53125897-53125919 TTATTTAAGCCATTGTGAGTAGG + Intergenic
1068199997 10:53771670-53771692 TTAGGTAAGTGGTAGGCAGTGGG + Intergenic
1070597841 10:77845166-77845188 TGAGTTAAGAGGTTGCCAGGGGG + Intronic
1070983066 10:80665815-80665837 TTAGTTAAGGGGGTGGCAGCAGG + Intergenic
1074797326 10:116961426-116961448 TTAGTTAAGTGGTTTTTGGTTGG - Intronic
1081516316 11:43833817-43833839 TTTGTTTAGCGATAGTCAGTTGG - Intronic
1082748673 11:56995474-56995496 TTATTGAAGTGGTTCTCAGTGGG + Intergenic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1085451433 11:76636386-76636408 TTATTTAGGCCGTTGGCAGTAGG - Intergenic
1092272324 12:7032999-7033021 TTAGATCAGCTGCTGTCAGTTGG + Intronic
1097489862 12:60253354-60253376 GTAAATAAGCGGTTGTCAGTGGG - Intergenic
1099425889 12:82522445-82522467 TTTGTTAAGCTGTTTGCAGTGGG + Intergenic
1101216131 12:102585478-102585500 TAAGTTAAGCGGTTGAGAGTTGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1116963250 14:50988734-50988756 TTAGTTAAGCTGGGATCAGTTGG - Intronic
1117031579 14:51677114-51677136 TTATTTAGTCTGTTGTCAGTGGG + Intronic
1117213280 14:53523822-53523844 TTAATTACGAGGTTGACAGTGGG - Intergenic
1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1124887070 15:33697122-33697144 TTAGGTAGGAGGTTGTCTGTAGG - Intronic
1127118689 15:55752509-55752531 TTAGTCAATCCGTTGTAAGTTGG - Intergenic
1132364041 15:101243055-101243077 TTAATTAAGCTGTTGGCAGGGGG + Intronic
1139837138 16:69848142-69848164 TTAGTTAAGAAGCTGTCAGCTGG + Intronic
1141076898 16:81014787-81014809 TAAGTTGAGCTGTTGTAAGTTGG - Intronic
1144710011 17:17395375-17395397 TCATTCAGGCGGTTGTCAGTAGG + Intergenic
1155026261 18:21943575-21943597 TTAGTTAAGCTGGTGTGTGTTGG - Intergenic
1159113281 18:64085110-64085132 TCAGTGAAGTTGTTGTCAGTGGG - Intergenic
1165574945 19:36807477-36807499 TTTGTTGAGCCGTTGTCATTTGG + Intergenic
1166053005 19:40271900-40271922 TTAGGACAGCGGTTGTCAGCTGG - Intronic
929275933 2:40024670-40024692 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
935339820 2:102049853-102049875 TTAGTGCCGCGTTTGTCAGTGGG + Intergenic
935655622 2:105420400-105420422 TTAGTTAAGAGGAGGTCATTAGG - Intronic
937494495 2:122403312-122403334 TTACTCCAGCGGTTCTCAGTGGG - Intergenic
1175069928 20:56324645-56324667 TCAGTTAAGCCCTTTTCAGTGGG + Intergenic
1179420163 21:41229127-41229149 TCAGATAAGCGGTTCTCAATGGG - Intronic
1181857207 22:25790651-25790673 TTAGTTAAGTGGTGGTGAGTTGG - Intronic
963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG + Intergenic
964311605 3:155399703-155399725 TTAGATAAGCAGTTCTCACTTGG + Intronic
965200505 3:165651337-165651359 TTAGTTAGATGGTTCTCAGTAGG - Intergenic
971151029 4:24031738-24031760 TTAATGAAGTGGTTCTCAGTTGG - Intergenic
975502552 4:75102586-75102608 TTAGCTGAGAGGTTGCCAGTTGG + Intergenic
979006535 4:115305384-115305406 TTAGCTAAGCAATTCTCAGTTGG + Intergenic
983582233 4:169320532-169320554 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
984731050 4:183068608-183068630 TTAGTTAAGGGGTTTTCCCTGGG - Intergenic
990328009 5:54697139-54697161 TGAGCCAAGCAGTTGTCAGTGGG - Intergenic
992514505 5:77477519-77477541 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
994520874 5:100833330-100833352 TTATTTAAACGTTTGTAAGTTGG + Intronic
997094982 5:130900376-130900398 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
997277310 5:132605869-132605891 TTATTTAACCGGTAGTCATTCGG - Intronic
998362835 5:141604750-141604772 TTAGTTAAGCGGTTGTCAGTAGG - Intronic
1003852418 6:10238815-10238837 TTAGTTAATATGTTGTCATTAGG - Intergenic
1007845346 6:44750270-44750292 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
1020694425 7:11395987-11396009 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
1024882344 7:54102453-54102475 TAAGTCAAGCCGTTGTCAGTTGG + Intergenic
1035333547 7:158111886-158111908 TTAGTTAAGCTGAGGTCAATAGG + Intronic
1037545193 8:19913290-19913312 GTAGTTGAGCGGTTTTGAGTGGG + Intronic
1040104768 8:43535379-43535401 TCAGTGAAGCCCTTGTCAGTGGG + Intergenic
1041619402 8:59948856-59948878 TTGGTTAAGCGGTTAACAGTAGG - Intergenic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1047481066 8:125283582-125283604 TTAATTAAGCAGTTTCCAGTTGG - Intronic
1054377725 9:64461901-64461923 TCAGTGAGGCCGTTGTCAGTGGG + Intergenic
1057379938 9:94558587-94558609 TTAGTTAAGAATTTGTCAGCTGG - Intergenic
1190856384 X:54299312-54299334 TTAGTTAAGTATTTGTCACTTGG - Intronic
1193707715 X:84843355-84843377 TTAGTCCAGCAGTTCTCAGTGGG + Intergenic
1194528906 X:95019047-95019069 TTAAAGAAGCGGTAGTCAGTTGG + Intergenic
1200889569 Y:8308990-8309012 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1201409930 Y:13689484-13689506 TTAGATTAGTGGTTGTCAGGGGG - Intergenic