ID: 998365194

View in Genome Browser
Species Human (GRCh38)
Location 5:141625967-141625989
Sequence TGAGAATGGCCTTCCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998365187_998365194 14 Left 998365187 5:141625930-141625952 CCCATGTGCCTTCAAACCAGGTC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG 0: 1
1: 0
2: 0
3: 14
4: 176
998365192_998365194 -2 Left 998365192 5:141625946-141625968 CCAGGTCATTCTGGAATCTGGTG 0: 1
1: 0
2: 2
3: 15
4: 136
Right 998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG 0: 1
1: 0
2: 0
3: 14
4: 176
998365188_998365194 13 Left 998365188 5:141625931-141625953 CCATGTGCCTTCAAACCAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 147
Right 998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG 0: 1
1: 0
2: 0
3: 14
4: 176
998365190_998365194 6 Left 998365190 5:141625938-141625960 CCTTCAAACCAGGTCATTCTGGA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998365194 Original CRISPR TGAGAATGGCCTTCCTGTTA TGG Intronic
903743141 1:25569961-25569983 AGAGAGTGGCCTTTCTGTGAGGG - Intergenic
908313323 1:62907461-62907483 CTAGAATGGCCTCCCTGTTTGGG + Intergenic
908438039 1:64126140-64126162 TGAGAATGGATTTCCTGGAAGGG + Intronic
908533428 1:65055326-65055348 TCAGAATTTCCTTCCTTTTAAGG + Intergenic
910287746 1:85574364-85574386 TGCGAATGGCCTTGCTGTCATGG - Intronic
910682487 1:89881842-89881864 TCAGCATGGCCTTGCTGTTCTGG - Intronic
917950652 1:180029987-180030009 TCAGAATGTTCTTCCTTTTAAGG + Intronic
918318799 1:183345604-183345626 TGACAAGGGCCTTCCTGCTGGGG - Intronic
918899777 1:190399714-190399736 TGTAAATGGCCTCCTTGTTATGG + Intronic
920595737 1:207268136-207268158 AGAGAATGGCCATCCAGTTTGGG + Intergenic
924588629 1:245381898-245381920 TCAGAATTTCCTTCCTTTTAAGG + Intronic
1062800801 10:379023-379045 GGAGACTGGCCTTTCTGTGAGGG + Intronic
1062838155 10:650012-650034 TCAGAATTGCCTTCCTAATAAGG - Exonic
1063862043 10:10321231-10321253 TCAGAATGTCCTTCCTGTATAGG - Intergenic
1064770628 10:18718825-18718847 TGTGTGTGGCCTTCCTGGTAAGG + Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067188094 10:44047109-44047131 TGAGATTGGCCTTTGTGTTTAGG - Intergenic
1070254187 10:74799943-74799965 TCAGAATTTCCTTCCTTTTAAGG - Intergenic
1070691280 10:78528385-78528407 GCAGAATGTCCTTCCTTTTAAGG + Intergenic
1072820850 10:98555814-98555836 TGATAATGGCCTTCTTCTTAAGG - Intronic
1075620848 10:123927192-123927214 AGAGACTGTCCTTCCTGTAAAGG - Intronic
1075952231 10:126490194-126490216 TTAGAATTTCTTTCCTGTTAAGG - Intronic
1075973342 10:126673451-126673473 TGGGAAAGGCCTTCCTGTCTGGG + Intergenic
1076081999 10:127590676-127590698 CGTGAATGGTCTTCCTGATAAGG + Intergenic
1076557592 10:131337992-131338014 TCAGAATCTCCTTCCTTTTAAGG + Intergenic
1076876164 10:133216847-133216869 TCAGAATTTCCCTCCTGTTAAGG - Intronic
1077399032 11:2344053-2344075 TGAGAACAGCCATCCTATTATGG + Intergenic
1078648321 11:13163475-13163497 TGAGAATGGCCTGCATGCAACGG - Intergenic
1080696364 11:34606224-34606246 GGAGAATGGCCTGCCTGTTTGGG + Intergenic
1081524574 11:43917369-43917391 TCAGAATTGCCTTCATGTTGTGG + Intronic
1083631690 11:64098565-64098587 TGTGGATGGCCATCCTGGTAGGG + Intronic
1085660148 11:78356817-78356839 TCAGAATGCCATTCCTTTTAAGG - Intronic
1085758772 11:79223910-79223932 TGAGAATGTCCACCCTGATAGGG + Intronic
1086023352 11:82259761-82259783 TAAGGAAGGACTTCCTGTTATGG - Intergenic
1086463200 11:87026144-87026166 TGAGATTGGCTTTGCAGTTAGGG - Intergenic
1087248086 11:95863688-95863710 TGAGAATGACATTCCTGTGGTGG - Intronic
1092793876 12:12091991-12092013 AGAGAATGATCTTCCTGTCACGG + Intronic
1093432477 12:19099491-19099513 AGAGAATAGACTTCATGTTATGG - Intergenic
1096193728 12:49635726-49635748 TGAGTATGGCCTTCTTCCTAGGG + Intronic
1100348984 12:93760766-93760788 TGAGAATCGCCTTACTCTTCAGG + Intronic
1100486007 12:95028027-95028049 TTAGAATTTCCTTCCTTTTATGG + Intronic
1100519749 12:95362680-95362702 TGAGAATGTTTTTCTTGTTAGGG + Intergenic
1101127406 12:101651337-101651359 TAAAAATGGCCTACCTGTTCAGG + Exonic
1103380839 12:120493195-120493217 TGAGACTGGCTTTCCATTTATGG + Intronic
1104359795 12:128121764-128121786 TCAGCATGGCCTTCCTCTTTAGG - Intergenic
1105381978 13:19895928-19895950 TTAGAATTTCCTTCCTTTTAAGG - Intergenic
1105849613 13:24322577-24322599 GGAGAATGGCCCTGCTGCTACGG - Intergenic
1106674762 13:31946908-31946930 TGAAAGTGGCCTTTTTGTTATGG + Intergenic
1107573309 13:41686893-41686915 TGAAGATGGCATTCCTGTGAAGG - Intronic
1107751041 13:43567220-43567242 TGATATTGACCTTCCTGTTAAGG - Intronic
1109909913 13:68895762-68895784 TTGGAATGGGTTTCCTGTTAAGG - Intergenic
1110445948 13:75580917-75580939 TGTGAATAGCCTTGCTTTTAAGG - Intronic
1110609032 13:77468234-77468256 TCAGAATTTCCTTCCTTTTAAGG - Intergenic
1113068966 13:106400211-106400233 TGTGAATGACCTTCCTGTTTAGG + Intergenic
1114420403 14:22577598-22577620 TCAGAATTTCCTTCCTTTTAAGG - Intronic
1118370566 14:65134241-65134263 TCAGAAGGGGCTTCCTATTAGGG + Intergenic
1122134160 14:99623123-99623145 TGAGCATGGCTTTCCTCCTAGGG - Intergenic
1122414813 14:101544000-101544022 TCAGAATGTCCTTCCTTTTCAGG - Intergenic
1124591119 15:31053900-31053922 TCAGAATTTCCTTCCTTTTAAGG - Intronic
1125312909 15:38400052-38400074 TCAGAATTCCCTTCCTTTTAAGG + Intergenic
1125666234 15:41432525-41432547 TTAGTACTGCCTTCCTGTTAAGG - Intronic
1129482764 15:75841463-75841485 TGGGAATGCCATGCCTGTTAGGG + Intergenic
1131030180 15:89179884-89179906 TGAGCAAGGCCTTCCTGCCATGG + Intronic
1131387602 15:92019914-92019936 TCAGAGTGGCCTTCATGTCAGGG + Intronic
1131937576 15:97523277-97523299 CCAGAATTGCCTTCCTGTTATGG - Intergenic
1132070682 15:98774513-98774535 TCAGAATGTCCTTCCTTTTTAGG - Intronic
1132800493 16:1749859-1749881 TGAGACAGGCCTCCCTGTCAGGG - Intronic
1135938380 16:26800067-26800089 TAAGAATGGCCTTTCTTTCAAGG + Intergenic
1138238881 16:55410410-55410432 TTAGAATTTCCTTCCTTTTAAGG + Intronic
1139261212 16:65595986-65596008 TGAGAACGCCCTTCCTGATCAGG + Intergenic
1139284717 16:65801152-65801174 TAAGAATTGACTTACTGTTATGG + Intergenic
1139325393 16:66148697-66148719 AGAGAATGGGCTTCCTGTCCCGG - Intergenic
1142806681 17:2375119-2375141 GGAGAATGGCCTTAGTGTTTTGG - Intronic
1143702711 17:8673205-8673227 TCAGAATATCCTTCCTATTAAGG - Intergenic
1144174920 17:12696011-12696033 TCAGAATTTCCTTCCTTTTAAGG + Intronic
1144211998 17:13023578-13023600 TGCAAATGGCCTTCCTCTTGCGG + Intergenic
1144711210 17:17402754-17402776 TGGGAATGGAGTTCCTGTCAGGG + Intergenic
1147520148 17:41163423-41163445 TGAGAATGGACTTCCTCAGATGG + Intergenic
1148434734 17:47674687-47674709 TGGTTATGGCCTCCCTGTTAAGG + Exonic
1149105316 17:52956665-52956687 TGAAAATGGCTTGCCTTTTAAGG + Intergenic
1150835431 17:68559393-68559415 TAACACTGGCCTTCCTTTTAAGG + Intronic
1151301563 17:73231255-73231277 TCAGAATGCTCTTCCTGTTACGG - Intronic
1155425459 18:25702047-25702069 TTAGAATGTCCTTCCTGGAATGG - Intergenic
1156549150 18:37996916-37996938 TTAGAATAGCCTTACTCTTAGGG - Intergenic
1167061013 19:47146419-47146441 TGAAAGTGGCCTTGCTGATAGGG + Intronic
1168421225 19:56205101-56205123 TGAGGATGGGGTTCCTTTTAGGG + Intronic
925396127 2:3534822-3534844 TGAGAATTCCCTTCCTTCTAAGG - Intronic
926193537 2:10745933-10745955 TCAGAATTCCCTTCCTTTTAAGG + Intronic
932216657 2:69970456-69970478 TGAGAAAGCCCGTCCTGTTTGGG - Intergenic
936896586 2:117434640-117434662 TCAGGATGGCTTTCCTGATAGGG + Intergenic
938068996 2:128298486-128298508 TCAGAATCGCCTTCCTTTTTAGG - Intronic
938719550 2:134053975-134053997 TCAGAATTTCCTTCCTTTTAAGG - Intergenic
943712522 2:191112963-191112985 TGGGAATGCCCTTCCTGCTAGGG - Intronic
944683756 2:202099771-202099793 TGAGATCTGCCTTCCTATTAGGG - Exonic
946487679 2:220116597-220116619 CCAGAATCGCCTTCCTTTTATGG - Intergenic
946683724 2:222245229-222245251 TAAGCTTGGCCTTCCTGTTTAGG - Intronic
946793546 2:223325864-223325886 TGAAAATGGCATTTGTGTTAAGG - Intergenic
946864737 2:224032547-224032569 TCAGAAAGGATTTCCTGTTACGG - Intronic
1170277783 20:14611684-14611706 AAAGAATGCCCTTCCTTTTATGG - Intronic
1178724188 21:35036665-35036687 TGAGAATGGCCTTTCTGCAGAGG - Intronic
1181364628 22:22366222-22366244 TGAGAATGGCCATGATGGTAGGG + Intergenic
1182275598 22:29186499-29186521 TCAGAATTGCCTTCCTTTTCAGG - Intergenic
1184980229 22:48090425-48090447 TGAGAATGGCCTCCCCCTTGGGG + Intergenic
949108806 3:233372-233394 AAAGAATGGCATTCCTGTTGGGG - Intronic
950197505 3:11019313-11019335 TCAGAATTTCCTTCCTTTTAAGG - Intronic
950445872 3:13037679-13037701 TCAGAATGTCCTTCCTTTTAAGG - Intronic
951452811 3:22858504-22858526 TGAAAAGAGCCTTCCTTTTAAGG - Intergenic
953104858 3:39867610-39867632 TGATAATGGCCATCCTAATAGGG - Intronic
954283936 3:49604537-49604559 TCAGAATTTCCTTCCTTTTAAGG + Intronic
956560808 3:70572084-70572106 TCAGAATTTCCTTCCTTTTAAGG + Intergenic
956888017 3:73579966-73579988 TGTGAAAGGCCTTCCTTTCATGG - Intronic
960337052 3:116430533-116430555 ATGGAATGGCTTTCCTGTTAAGG - Intronic
962721595 3:138180600-138180622 TCAGGAAGGCCTTGCTGTTAGGG + Intergenic
962843235 3:139253863-139253885 TGAGAATTGTCTCCCTGTTTAGG - Intronic
962887794 3:139643548-139643570 TCAGAATTGCCTTCCTTGTAAGG - Intronic
963624917 3:147659174-147659196 TTAGAATGTCCTTCTTTTTAAGG + Intergenic
965187602 3:165484867-165484889 TGAGAATTTCCTTCCTTTTTAGG - Intergenic
966098153 3:176231060-176231082 TGAGAATTGGCTTCCACTTAGGG + Intergenic
966194561 3:177300065-177300087 AGAGAATGCCCTTACTGGTAAGG + Intergenic
973913851 4:55612734-55612756 TGAGAATTGGCTTCTTGTAAAGG - Intronic
978360875 4:107930569-107930591 AGATAATGGCTTTCCTGATAAGG - Intergenic
980311591 4:131137196-131137218 TTAAAATGGTCTCCCTGTTAGGG - Intergenic
981833176 4:149025534-149025556 TGAGAATGCCCTTCCTTCTATGG + Intergenic
982104354 4:151998645-151998667 TCAGAATGGCTTTCATGTTTGGG + Intergenic
982605821 4:157515177-157515199 TGAGCATTGCCTCCCTGTAAGGG + Intergenic
983926701 4:173410374-173410396 TAGGAATGGCCTTGCTGCTATGG - Intergenic
985624157 5:976299-976321 TCAGAATCTCCTTCCTGTTAAGG - Intergenic
985793105 5:1942352-1942374 TCAGAATTTCCTTCCTGTTTAGG + Intergenic
988292117 5:29300636-29300658 CTAGAATGGCTTTCTTGTTATGG + Intergenic
988332817 5:29864679-29864701 TGAGTCTGGCCTTCCTCCTACGG + Intergenic
988591302 5:32552180-32552202 TAAGAATGGCCCTCTTGTAAAGG - Intronic
989671419 5:43921729-43921751 TGAGAATGGTCTACATGCTAAGG + Intergenic
992552026 5:77868211-77868233 AGAGAACGGCCCTCCTGTTTGGG + Intronic
993057853 5:83003091-83003113 TGAAAATTTCCTTCCTGTCAAGG - Intergenic
993144955 5:84082082-84082104 TGAGAATGGATTGCCAGTTATGG + Intronic
995369907 5:111407575-111407597 TGATAATATCCTTCCTGTCATGG - Intronic
995550927 5:113280582-113280604 TGAGAAAGGCCTTCCAGAGAAGG + Intronic
995876094 5:116791728-116791750 AGAGAAGGGCATTCCTGTTGGGG + Intergenic
998365194 5:141625967-141625989 TGAGAATGGCCTTCCTGTTATGG + Intronic
998511041 5:142714123-142714145 TCAGAATTGCCTTCCTTTTAGGG + Intergenic
1000727391 5:164788868-164788890 TGAGAATAGTCTTACTTTTAGGG - Intergenic
1002431045 5:179204012-179204034 TAAGAATGTCCTTCCTTTTCAGG - Intronic
1003474117 6:6465661-6465683 AGAGAATACCCTTCCTGGTATGG - Intergenic
1005102852 6:22191984-22192006 TGAGAATGGCATCCCTGTGAAGG + Intergenic
1005758211 6:28944305-28944327 TGCGAAAGGCCTTCCTGTACGGG - Exonic
1009349379 6:62654567-62654589 TGAGAAAGGCCTTGCACTTAAGG - Intergenic
1011567953 6:88699734-88699756 TCAGAATGTCATTCCTTTTAAGG - Intronic
1012404130 6:98875352-98875374 TGAGATTGGCTTTTCTGTCAAGG + Intronic
1012428859 6:99142995-99143017 TGAGAATTGCATTTCTGATAAGG + Intergenic
1014158541 6:118139457-118139479 TGGAAATGGCTTTTCTGTTATGG + Intronic
1016336508 6:143011113-143011135 TTAGAATGCCCTTCCTCTTTAGG - Intergenic
1017663803 6:156699134-156699156 TGACTATGGCACTCCTGTTAAGG + Intergenic
1019267990 7:129497-129519 TGAGGATGGCATTCCTCCTATGG + Intergenic
1019789538 7:3001991-3002013 TGAGAAAGGGCTTCCTGTATTGG - Intronic
1021795629 7:24251010-24251032 TGAGGATTGCCTCCCTGTCAGGG - Intergenic
1022324086 7:29314208-29314230 TTAGAATATCCTTCCTTTTAAGG - Intronic
1022462004 7:30618049-30618071 TCAGAATGGCTTTCTTTTTATGG + Intronic
1026561137 7:71450641-71450663 TGAGAATGGCGTTTCTTTTAAGG - Intronic
1026924273 7:74178946-74178968 TAAGCATGGCCTTCCAGTTCAGG + Intronic
1029107431 7:98189777-98189799 TGAGAAGGGCGTTCCTGCTGTGG + Intronic
1031484531 7:122311284-122311306 GTAGAAAGGCCTTTCTGTTAAGG - Intergenic
1031863824 7:127014826-127014848 TAAGTGTGGCCTTCCTGTGAAGG + Intronic
1032565779 7:132941470-132941492 TCAGAATGGCATGGCTGTTATGG - Intronic
1033442393 7:141391852-141391874 TGAGAATGTTCTTCCCTTTAAGG + Intronic
1033583853 7:142760059-142760081 GGAGAATGGCCTGGCTGTTTAGG - Intronic
1033585327 7:142770633-142770655 GGAGAATGGCCTGGCTGTTTAGG - Intergenic
1035105584 7:156439698-156439720 TGAGAAACCCTTTCCTGTTAGGG - Intergenic
1036243149 8:7095598-7095620 TGAGAATAACCTTCCTGATCTGG - Intergenic
1036898678 8:12655833-12655855 TGAGAATAACCTTCCTGATCTGG + Intergenic
1039997756 8:42549111-42549133 CCAGAATGTCCTTCCTTTTAAGG - Intronic
1040567530 8:48581407-48581429 TATGAAGGGCCTTCCAGTTAAGG - Intergenic
1040989300 8:53332365-53332387 TCAGAATGTCATTCCTTTTATGG + Intergenic
1041687490 8:60657760-60657782 TCAGAATTTCCTTCCTTTTAAGG - Intergenic
1041940134 8:63377945-63377967 TCAGAATTTCCTTCCTTTTAAGG + Intergenic
1045171333 8:99672694-99672716 TGAGAATGGCCATTCTTGTAGGG + Intronic
1045376997 8:101584491-101584513 TCAGCATGGCTATCCTGTTAAGG + Intronic
1045709868 8:104970590-104970612 TGAAAATGGCCATCATGTGAAGG + Intronic
1056083636 9:83123270-83123292 GGAGAATGCTATTCCTGTTATGG - Intergenic
1058017643 9:100053783-100053805 TTAGAATGGCCATTCTCTTACGG + Intronic
1059207070 9:112476998-112477020 TGAGGATTGCCTCCCTGTCAGGG - Intronic
1059721204 9:116961542-116961564 TCAGAATGTCCTTCCTTTTTAGG + Intronic
1059977079 9:119728979-119729001 TGAGACTTTCCTTCCTGTTGGGG + Intergenic
1060473557 9:123968677-123968699 TCAGAATTGCCTTCCTTTTTAGG + Intergenic
1061223490 9:129266511-129266533 TCAGAATTCCCTTCCTTTTAAGG + Intergenic
1189908705 X:45787948-45787970 TAAGAATTGCATTCCTCTTATGG - Intergenic
1191147349 X:57181459-57181481 TGTGAATGGGCTTCCTGATTTGG - Intergenic
1193451260 X:81671002-81671024 TCAGAATTGCTTTCCTTTTAAGG + Intergenic
1195650773 X:107281645-107281667 TGAGAATGATCTACATGTTAAGG - Intergenic
1198791521 X:140352114-140352136 TGAGCATGGCCTTTCTGATGAGG + Intergenic
1201958028 Y:19647568-19647590 TGACAATGGCCTTTCATTTAAGG - Intergenic
1202069767 Y:20978793-20978815 TGACAATGGCCTTTCATTTAAGG - Intergenic