ID: 998365545

View in Genome Browser
Species Human (GRCh38)
Location 5:141628446-141628468
Sequence CAGTTGTCCTTAAGGATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998365545_998365548 0 Left 998365545 5:141628446-141628468 CCATTCATCCTTAAGGACAACTG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 998365548 5:141628469-141628491 GCCCAACAGCAGACAATACCAGG 0: 1
1: 0
2: 0
3: 7
4: 89
998365545_998365553 20 Left 998365545 5:141628446-141628468 CCATTCATCCTTAAGGACAACTG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 998365553 5:141628489-141628511 AGGCAGAAGAGGTTATTTCAAGG 0: 1
1: 0
2: 3
3: 32
4: 248
998365545_998365551 9 Left 998365545 5:141628446-141628468 CCATTCATCCTTAAGGACAACTG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 998365551 5:141628478-141628500 CAGACAATACCAGGCAGAAGAGG 0: 1
1: 0
2: 1
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998365545 Original CRISPR CAGTTGTCCTTAAGGATGAA TGG (reversed) Intronic
902034959 1:13450982-13451004 CAGTTGTTTCTAAGGAAGAAAGG + Intergenic
906943840 1:50278706-50278728 CAATTGTCCTTAAGGAACAGGGG - Intergenic
908097691 1:60757590-60757612 CATGTGTTCTTAAGGATGGAGGG - Intergenic
910248736 1:85171345-85171367 CAGTTGTGACTAAGGAAGAATGG + Intronic
910885865 1:91962864-91962886 AAGTTGTCCTAAAGGATTTATGG + Exonic
914758142 1:150578219-150578241 AAGTTTGCCTTAAGGATGAAAGG - Intronic
914800811 1:150961062-150961084 CATTAGTCTTGAAGGATGAATGG - Exonic
915683642 1:157607761-157607783 CAGTTATCCTTTAGGAATAAAGG + Intergenic
916419899 1:164627199-164627221 CATTTTTCCTTAAGGAAAAAAGG - Intronic
917612408 1:176701954-176701976 CAGTTGACCCTAGAGATGAAAGG - Intronic
919994071 1:202731603-202731625 CCATTGTCCTCAGGGATGAAAGG - Intronic
921115327 1:212084848-212084870 CAGTTGTCCCTCAGGATCCATGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923424627 1:233856382-233856404 CAGTTGTCCTTCAGTATAAGCGG - Intergenic
924426979 1:243960378-243960400 TGGATGTCCTTAAGGATGGAGGG - Intergenic
1066063614 10:31746038-31746060 CAGCTGCCCTGAAGGATGAGGGG - Intergenic
1068385539 10:56322250-56322272 AAGTTGTCCTGGAGGATGGATGG - Intergenic
1070293960 10:75142862-75142884 CATTTGTCCTTCAGGATAGAAGG - Intronic
1070294567 10:75148795-75148817 CATTTGTCCTTCAGGATAGAAGG + Intronic
1070648098 10:78215477-78215499 CTGTTGTCCTTAAGGATTTAGGG + Intergenic
1070796892 10:79222078-79222100 CAGCTTTCCTTAGGGATGAGTGG + Intronic
1072781899 10:98257193-98257215 CAGTTGTCGTTAATGGTGGAGGG - Intronic
1076403824 10:130199877-130199899 CAGTTGCCCTTAATGCAGAATGG + Intergenic
1086578069 11:88363112-88363134 CAGTTGTCCAGTAGGATGCATGG - Intergenic
1087418592 11:97890597-97890619 CAGTTTTCCTCAAGTTTGAATGG + Intergenic
1090967762 11:131613681-131613703 CAGTAGTGGGTAAGGATGAAAGG - Intronic
1091528603 12:1332456-1332478 TAGTTCTCCTTAAACATGAAGGG - Intronic
1099460273 12:82912632-82912654 CAATTGTGGTTAAGAATGAATGG + Intronic
1100490938 12:95077271-95077293 AAGTTGTCCTTAGGGATAGAAGG + Exonic
1100962545 12:99979194-99979216 CAGATTTCTTTAAGGATGAAAGG + Intronic
1101238235 12:102811774-102811796 CAGTACTCATTAAGGAAGAAAGG + Intergenic
1101562458 12:105870651-105870673 AAGTTGAGATTAAGGATGAAGGG - Intergenic
1101666502 12:106820946-106820968 AAGAAGTCCCTAAGGATGAAGGG - Intronic
1102270784 12:111533260-111533282 CAGTTGTCCTTCAGCATCTATGG + Intronic
1102646961 12:114409812-114409834 CAGTTCTCCGAAAGGAGGAAGGG - Intergenic
1103925448 12:124421326-124421348 CAGTCCTCCTTCAGGATGAGGGG - Intronic
1107581050 13:41786404-41786426 GAGATGGCCTTAAAGATGAATGG + Intronic
1107712756 13:43166921-43166943 AATTAGTCCTTAAAGATGAAAGG - Intergenic
1107720997 13:43247716-43247738 CAGATGTCTTTGAGGGTGAAAGG - Intronic
1109781585 13:67117353-67117375 CAGAGATCCTTAAGGCTGAAAGG - Intronic
1112157106 13:96830325-96830347 CATTTGTACTTAAAGATAAATGG - Intronic
1112399551 13:99063834-99063856 GAGTTGTGCTTGAAGATGAATGG - Intronic
1118984035 14:70738337-70738359 CAGTCGTCCCAAAGGAGGAAGGG - Exonic
1121683852 14:95817104-95817126 CAGTTGTCCATAACAAAGAATGG + Intergenic
1122287449 14:100660022-100660044 CAGTTGTCATTGGGGATGGAGGG + Intergenic
1123023577 14:105413202-105413224 CAGGTGTCCTTAAGGGTGTGGGG + Exonic
1129133131 15:73518804-73518826 CTTTTGACCTAAAGGATGAATGG + Intronic
1130045172 15:80438015-80438037 CAGTTTTCCTTAATGCTGAATGG + Intronic
1139538072 16:67591687-67591709 CAGTTTTTCCTGAGGATGAAAGG - Intronic
1140402133 16:74680111-74680133 CAGCTGTCTATAAGGGTGAAAGG + Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1141799064 16:86295027-86295049 CAGAGGTCCTAAAGGGTGAAGGG - Intergenic
1144242043 17:13322244-13322266 CTGTTGTCCTTAAGAGTGCAAGG - Intergenic
1147555381 17:41475759-41475781 CAGATGTCCTTAAGGGACAAGGG + Intergenic
1157695918 18:49723578-49723600 CAGTTTTCCTAAAGGATTTAAGG + Intergenic
1158248691 18:55462127-55462149 TAGTTTTCCTTAAGGTTGAGGGG - Intronic
1160491167 18:79337589-79337611 CAGATGTCCCTAAGGAAGGAGGG - Intronic
1162216465 19:9138211-9138233 TAGTTCTCCTTAAGGATGTGAGG - Intergenic
1166341208 19:42138374-42138396 CTGAGGTCCTGAAGGATGAAAGG + Intronic
925678665 2:6393766-6393788 GAGTTGTGCTTTAGGATTAAGGG - Intergenic
929287468 2:40151973-40151995 CAATTCTCATCAAGGATGAATGG + Intronic
929584659 2:43106101-43106123 AAGTTGTCCACAAGGAGGAATGG - Intergenic
929712328 2:44277862-44277884 CATTTGTCTTTGAGGTTGAAGGG + Intronic
930409195 2:51002044-51002066 CAGTTGTACAAAAGTATGAATGG - Intronic
930616675 2:53601183-53601205 CAGATGTCTGTAAGGATGGATGG - Intronic
931655104 2:64503707-64503729 CTGTTGTCATTAATTATGAAGGG - Intergenic
931829563 2:66036722-66036744 CAGTTGGTCCTAAGTATGAAAGG + Intergenic
936465429 2:112744509-112744531 CAGTTTTCTGTTAGGATGAAGGG - Intronic
939819722 2:146942901-146942923 GAGTTGTCATTAAGGATGTTAGG + Intergenic
941733534 2:168946648-168946670 AAGGTGACCTTAAGGAGGAATGG - Intronic
942831878 2:180246437-180246459 CAGCTGTCCCAAAGCATGAATGG - Intergenic
943334806 2:186600498-186600520 CAGTTATCTCTAAGGATGAGAGG - Intronic
943419289 2:187650020-187650042 CCTTTTTCCTTAAGGATGATGGG - Intergenic
943594051 2:189833902-189833924 AAGTTCTTCCTAAGGATGAAAGG - Intronic
946113934 2:217445494-217445516 CTGTTGTCCTGCTGGATGAAAGG - Intronic
947378252 2:229519718-229519740 CAGATGCCCTTAAGGGTGAAGGG - Intronic
947681867 2:232041352-232041374 CAGTTGTCATATAGGAGGAAGGG + Intronic
948536539 2:238651353-238651375 CAGTTATCATTAGGGATGGATGG - Intergenic
1172923289 20:38506253-38506275 CAGTTGTCCTTCAGAATTATAGG - Intronic
1176308101 21:5134910-5134932 CTGTTGTCCCTGAGGATGGATGG - Intronic
1177805389 21:25869955-25869977 CTGGTGTTCTGAAGGATGAATGG + Intergenic
1178595631 21:33950162-33950184 CAGCTTTCCTTAAGGAGGAATGG - Intergenic
1179091257 21:38267845-38267867 CAGTTGACTTTGAGGAGGAAGGG - Intronic
1179297353 21:40075167-40075189 CAGTTGTCCAAAACGAAGAAGGG - Exonic
1179473108 21:41625385-41625407 CAGAAGTGCTTCAGGATGAATGG - Intergenic
1179473769 21:41630473-41630495 CCGGGGTTCTTAAGGATGAATGG - Intergenic
1179848959 21:44127122-44127144 CTGTTGTCCCTGAGGATGGATGG + Intronic
1183602501 22:38848118-38848140 CAGGTGTCCCTAAGGAAGAGAGG - Intergenic
952685172 3:36139347-36139369 CAGGTGTAATAAAGGATGAATGG - Intergenic
953335251 3:42088986-42089008 CATCTGGCCTTAAGGAGGAAGGG - Intronic
955465004 3:59228004-59228026 CAGTTGTTTTAAAAGATGAATGG + Intergenic
955476446 3:59341124-59341146 CAGTTGTCCTTCAGTATCCATGG - Intergenic
959853812 3:111123770-111123792 AAGTTGTACTTCAGGGTGAAGGG - Intronic
962177640 3:133171259-133171281 CAGTTTTGCTTAAGGATGTTAGG + Intronic
962422003 3:135237206-135237228 CAGATGACCTTGAGGATGACAGG + Intronic
970411038 4:15808156-15808178 CAATTTTGCTTAAGGATGCAAGG + Intronic
977175614 4:93816258-93816280 CAGTTGACTTTAAGTAAGAAAGG + Intergenic
978796915 4:112717112-112717134 CAGTTTTCCTTTATAATGAATGG + Intergenic
980953924 4:139409223-139409245 CTGATGTCCTTAAACATGAAAGG - Intronic
983837609 4:172411674-172411696 CAGTTGTCCTAAGGGCTGAAGGG + Intronic
984358073 4:178690901-178690923 CACATGGCCTTAAGGGTGAAAGG - Intergenic
988328456 5:29802152-29802174 CAGTTGTTCTTAATCATGAATGG - Intergenic
990347686 5:54885554-54885576 CAGCTGGCCTTGTGGATGAATGG - Intergenic
992773600 5:80071006-80071028 CAGTTATCCTAAAAGATGAAAGG - Exonic
993765145 5:91846401-91846423 CTGTTGTCATCAAGAATGAATGG + Intergenic
994604473 5:101949980-101950002 CAGTTGTTCTTATGGAAGTAAGG - Intergenic
998091689 5:139374747-139374769 CAGCTGTTGTTAAGGATGACTGG + Intronic
998365545 5:141628446-141628468 CAGTTGTCCTTAAGGATGAATGG - Intronic
1008092375 6:47307145-47307167 CAGTCACCCTTCAGGATGAAGGG + Intronic
1010113947 6:72277961-72277983 CAATCGTCTTTAAGAATGAAAGG + Intronic
1010735007 6:79434288-79434310 CAGTTTTACTCAATGATGAATGG + Intergenic
1011879520 6:92007288-92007310 CAGTTTTCTTCCAGGATGAAAGG + Intergenic
1013421507 6:109971202-109971224 CAGATCTCCTTAAGCAGGAATGG - Intergenic
1013603396 6:111726012-111726034 CAGCTGCCTTTAAAGATGAAGGG + Intronic
1013697152 6:112716817-112716839 GAGTTGACCTTAAGAATGCAAGG + Intergenic
1015769080 6:136750503-136750525 CAGTTCTCTTCAACGATGAAGGG + Intronic
1017127406 6:151078951-151078973 CAGTAGGCCTGCAGGATGAAGGG + Intronic
1017159599 6:151352293-151352315 AAGTTGCCCTTAAAGGTGAAGGG + Exonic
1018257003 6:161930857-161930879 CTGTTGGCCATGAGGATGAAAGG + Intronic
1020385363 7:7594990-7595012 TAGATGTTCTTAAAGATGAAAGG + Exonic
1026525088 7:71146449-71146471 CTTTTGGCCTGAAGGATGAAGGG + Intronic
1035047432 7:155977675-155977697 CAATTGTACTTTAGGATGCAAGG - Intergenic
1036908215 8:12726204-12726226 CATTTGTCTTTATGGATCAATGG + Intronic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038890048 8:31711322-31711344 AAGTTGTCCTTTAGGAATAAAGG - Intronic
1039639792 8:39206630-39206652 AAGGTGACCTCAAGGATGAAGGG - Intronic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1044265791 8:90179695-90179717 CACTTGTACTTATGGATGACTGG - Intergenic
1044790382 8:95841082-95841104 CTGTGGCTCTTAAGGATGAAGGG - Intergenic
1045261139 8:100575504-100575526 CAGTTGTCCTCTCGGATGAGTGG - Intronic
1045348400 8:101315779-101315801 CAGTGGTCATTAAGATTGAAGGG - Intergenic
1045448194 8:102289222-102289244 AACTTGTCTTTAAGGATTAAGGG - Intronic
1046496466 8:115020628-115020650 CAGTTGTGCTTAGGAATAAATGG + Intergenic
1047059894 8:121213595-121213617 CAATTTTACTTTAGGATGAAGGG - Intergenic
1048496370 8:134939445-134939467 CAGGTGGCCTTCAGGCTGAATGG + Intergenic
1048745279 8:137607762-137607784 TATTTGTTCTTAAGGATGCATGG - Intergenic
1049072086 8:140364005-140364027 CAGTTCCACTTAAGGCTGAAAGG + Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1053206378 9:36190047-36190069 CTGCTGTCCTTAGGGAGGAAAGG + Intergenic
1053395991 9:37774882-37774904 AACTTGTCCTGAATGATGAAGGG + Intronic
1053633575 9:39971007-39971029 CAATTGTCATTCAGTATGAATGG - Intergenic
1054210312 9:62279690-62279712 CAATTGTCATTCAGTATGAATGG + Intergenic
1055783703 9:79848332-79848354 CAGTGGTGCTTTAGAATGAATGG - Intergenic
1062062442 9:134503692-134503714 CAGTAGACCTGAAGGATGAGGGG - Intergenic
1062658494 9:137616012-137616034 CAGTTCTCCTTTAGGGCGAAGGG + Exonic
1186104261 X:6189192-6189214 CAGTTGTCCTTGAGGAGGGGTGG - Intronic
1186499848 X:10042362-10042384 CACTTGTCCTTAGGGATCATGGG + Intronic
1189314821 X:40047617-40047639 CAGTTGTTTTTAATGAGGAAAGG + Intergenic
1195022178 X:100840284-100840306 CTGTTGTCATTAGAGATGAATGG + Intronic
1195238666 X:102928403-102928425 CAGTTGTCTTTAAGGTACAATGG - Intergenic