ID: 998365620

View in Genome Browser
Species Human (GRCh38)
Location 5:141628908-141628930
Sequence GGGAATAGCCATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998365614_998365620 -3 Left 998365614 5:141628888-141628910 CCACCACGCTTATATTCTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 40
Right 998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG No data
998365616_998365620 -6 Left 998365616 5:141628891-141628913 CCACGCTTATATTCTTAGGGAAT 0: 1
1: 0
2: 1
3: 3
4: 73
Right 998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG No data
998365612_998365620 -2 Left 998365612 5:141628887-141628909 CCCACCACGCTTATATTCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998365620 Original CRISPR GGGAATAGCCATGAGGAGGA GGG Intronic
No off target data available for this crispr