ID: 998370224

View in Genome Browser
Species Human (GRCh38)
Location 5:141656016-141656038
Sequence AGGGTGCAGAGGTGGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 1, 2: 2, 3: 60, 4: 562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998370224 Original CRISPR AGGGTGCAGAGGTGGGCCAG AGG Intronic
900003595 1:29430-29452 AGGGCGCAGTGGAGGGCGAGCGG - Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900216841 1:1486247-1486269 TGGCTGAACAGGTGGGCCAGGGG + Intronic
900223922 1:1523976-1523998 TGGCTGAACAGGTGGGCCAGGGG + Intronic
900290656 1:1922247-1922269 AGGGTGGACAGGAGGGCCCGAGG + Exonic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
900872542 1:5314411-5314433 AGGGGAAAGAGGTGAGCCAGAGG - Intergenic
901201666 1:7470737-7470759 AGGCTACAAAGGTGGGGCAGTGG - Intronic
901334679 1:8439190-8439212 AGAGAGCAGAGGTGGGCAAGTGG - Intronic
902112374 1:14093115-14093137 AGGATGCAGAGGTGGGTCAGAGG - Intergenic
902329571 1:15724738-15724760 GGGGTGCAGAGTGGGGGCAGAGG - Intronic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902509908 1:16960915-16960937 AGGCTGCAGAGCTGGGCCTGCGG + Exonic
902561921 1:17282951-17282973 AAGGTGCAGTGGAGGCCCAGCGG - Exonic
902628785 1:17692517-17692539 GGGGAGCAGAGGTGGAGCAGAGG - Intronic
902822546 1:18952003-18952025 AGAGGGCAGCGGTTGGCCAGAGG + Intronic
903499196 1:23792343-23792365 AGGGGGCAGAGGGGAGGCAGCGG - Intronic
903668293 1:25021231-25021253 AGGGTGCAGACGGGGGACGGAGG + Intergenic
903768451 1:25749437-25749459 AGGGGGCAGGGATGGGCCTGGGG + Intronic
905168646 1:36098004-36098026 AGGGTGCCGTGCTGGGCAAGGGG - Exonic
905176066 1:36136097-36136119 AGGGTTCAAAGCTGGGCCAAAGG - Intergenic
905293235 1:36937599-36937621 AGGGAGCAGCGGTGGAGCAGAGG + Intronic
905402568 1:37714402-37714424 AGGCTGCAGGTGTGGGCCAAAGG - Intronic
905626622 1:39493738-39493760 AGGGTGGGGATGTGGGACAGAGG + Intronic
905670268 1:39786718-39786740 AGGGTGGGGATGTGGGACAGAGG - Intronic
905766699 1:40607517-40607539 AGGGTGAGGAAGTGGGGCAGGGG - Intergenic
906641562 1:47444015-47444037 AGGGAGGAGGGGTGGGCCTGGGG - Intergenic
906724014 1:48030511-48030533 ACCGTGCAGAGGTGGGCAGGGGG - Intergenic
907053031 1:51342586-51342608 AGGGTGGTGTGGTGGGCGAGGGG + Intronic
907328746 1:53657880-53657902 AGGGTGCAGAGAAGGGGCAAGGG - Intronic
908429341 1:64040781-64040803 AGGGTGAAGAGGTGGGGCCTTGG - Intronic
909498672 1:76309131-76309153 AGGGTGCTGTGGGAGGCCAGAGG - Intronic
912624800 1:111198062-111198084 AGGGTGGAGAGGAGGGCAAAGGG + Intronic
912763209 1:112386699-112386721 GGGGAGCTGAGGTGGGGCAGAGG + Intergenic
912878894 1:113390186-113390208 AGGGCGCAGAGGAGGGGCAGGGG - Intergenic
914247272 1:145895658-145895680 TGGATGCACAGGTGGGCCTGGGG + Exonic
914433213 1:147638596-147638618 AGGCTGGAGAGGTGGGCAGGGGG + Intronic
914994178 1:152526871-152526893 ATGGTGCTGAGGTGGTGCAGAGG - Intronic
915436509 1:155910922-155910944 AGGGTGCAGTGGTGAGCAAGAGG - Intronic
915541080 1:156566641-156566663 AGGAAGCAGAGGAGGGTCAGGGG - Intronic
918123221 1:181557769-181557791 AGGGGGCAGAGCTGGCTCAGCGG + Intronic
918514434 1:185346916-185346938 AGGGAGGGGAGGTGGTCCAGTGG - Intergenic
919914232 1:202130096-202130118 AGGGACCAGAGGTGGGGCTGGGG - Exonic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
921007864 1:211112145-211112167 ACGGTGCAGTGGCGGGGCAGAGG - Intronic
921502072 1:215916726-215916748 GGGGGGCAGAGGTGGGTCAAGGG + Intronic
922801809 1:228367966-228367988 AGGGTGCATGGCTGGGGCAGTGG - Intronic
923025134 1:230197857-230197879 AGGGTGCAGAGCTGGCCAACAGG - Intronic
924453615 1:244200427-244200449 AGGGGACAGAGCTGGGCCTGGGG + Intergenic
1063372542 10:5531277-5531299 GGGGTCCAGTGCTGGGCCAGAGG - Intergenic
1063457125 10:6191707-6191729 AGTGGACAGCGGTGGGCCAGAGG - Intronic
1063539782 10:6920245-6920267 AGGGTGCAGAGCTAGGGTAGTGG + Intergenic
1064179232 10:13100318-13100340 GGGCTGCAGCGGTGGGCGAGGGG + Intronic
1065099958 10:22322066-22322088 AGGGTGCGGAGGGGCGCCCGGGG - Intronic
1065441274 10:25755912-25755934 ACAGTGCAGTGGTGGGCCAAAGG - Intergenic
1065610052 10:27463834-27463856 AGGGTGCAGAAGTGGCCAGGTGG + Intergenic
1065811261 10:29445856-29445878 AGGGTGCAGAAGTGGCTAAGTGG + Intergenic
1065824585 10:29558156-29558178 AGAGTGCAGTGCTGGGCTAGTGG - Intronic
1065976940 10:30849904-30849926 AGGGTGGTGAGGTGGGGAAGGGG + Exonic
1067024968 10:42836880-42836902 AGGGCGCAGAGCTGGGAGAGCGG - Intergenic
1067109700 10:43391536-43391558 AGGGTGCTGGGGTAGGACAGTGG - Intronic
1067461546 10:46461998-46462020 ATGGTGCGGTGGTGAGCCAGTGG + Exonic
1067625648 10:47922603-47922625 ATGGTGCGGTGGTGAGCCAGTGG - Intergenic
1068679413 10:59803596-59803618 AGGGTGGAGTGGGTGGCCAGTGG - Intronic
1070267215 10:74915398-74915420 AGGGAGCAGAGGTATGGCAGGGG - Intronic
1070364564 10:75723762-75723784 ATGGTGTAGCGGTGGGACAGTGG + Intronic
1071039216 10:81286539-81286561 AGGGGGCACAGGGGTGCCAGGGG - Intergenic
1071299409 10:84245188-84245210 GGGGTGCAGCGGGGGCCCAGTGG + Intronic
1071718227 10:88118167-88118189 AAGATGCAGAGGTGGTCCAGAGG + Intergenic
1072041249 10:91608836-91608858 AGGGAGTGGAGGTGGGGCAGGGG + Intergenic
1073569434 10:104564136-104564158 AGAGTGCAGCGGTGGGGCATTGG + Intergenic
1073611259 10:104946310-104946332 AGGGTGCAGAGGGGTCCCAAAGG - Intronic
1075091690 10:119447372-119447394 AGGGTGCAGAGATGGGTCAAGGG - Intronic
1075719673 10:124577326-124577348 AGGCTGTATGGGTGGGCCAGGGG - Intronic
1075731485 10:124639179-124639201 GGGATTCAGAGGTGGGCCATGGG + Intronic
1075936117 10:126342912-126342934 AGGGTGGAGGGGTGGGGCATGGG + Intronic
1076005346 10:126944311-126944333 AGGGTGCAGGGCTGTGCCCGTGG + Intronic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076572536 10:131441983-131442005 AGGATGCAGAGGTTGGTCATCGG + Intergenic
1076595826 10:131623679-131623701 TGGGGGCAGAGGTGGGGGAGAGG + Intergenic
1076595834 10:131623702-131623724 TGGGGGCAGAGGTGGGAGAGAGG + Intergenic
1076626522 10:131824488-131824510 AGGGTGAAGAGGGGAGCCATGGG + Intergenic
1076670374 10:132117654-132117676 AGGGTGCAGGCGTGGGCTCGGGG + Intronic
1076818829 10:132928054-132928076 TGGGGGCAGAGTTGGGCCACAGG + Intronic
1076890856 10:133282621-133282643 AGGGTCCGGAGGAGGGCGAGTGG - Intronic
1077024558 11:433477-433499 AGGGTTCTGAGGTGGGATAGAGG - Intronic
1077199361 11:1297739-1297761 AGGGTGCAGAGGTGCCTGAGCGG + Intronic
1077361095 11:2140437-2140459 AGGGGGGCGAGGGGGGCCAGGGG - Intronic
1077407570 11:2389425-2389447 TGTGTGCAGAGGGGGGCCTGGGG + Intronic
1078079303 11:8192524-8192546 AAGGTGGAGAGGTGGGGAAGAGG + Intergenic
1081113069 11:39161619-39161641 AAGGGGCAGAGGTGGGCCCTTGG - Intergenic
1081705129 11:45178441-45178463 AGGGTGCAGAGGTGCACTGGGGG - Intronic
1081754338 11:45533894-45533916 AGGGTCCAGAGGTGACACAGTGG + Intergenic
1081811926 11:45918886-45918908 TGGGTGGAGCCGTGGGCCAGTGG + Intergenic
1081963883 11:47157753-47157775 TGGATGCAGAGGTGGCCCTGAGG + Intronic
1083419790 11:62546318-62546340 AGGGAGAGGAGGTGGGACAGAGG + Intronic
1083725804 11:64627389-64627411 AGGGTGCAGAGGAAGGCGGGGGG - Intronic
1084329593 11:68422849-68422871 AGGGTGCAGGGGCGGGTGAGTGG - Intronic
1084408223 11:68991258-68991280 TGGGTGCACAGGTGACCCAGAGG - Intergenic
1084470971 11:69358750-69358772 AGGGTGCAGAGGGTGGGCTGTGG + Intronic
1084603330 11:70159239-70159261 TGGGGGAAGAGATGGGCCAGGGG + Intronic
1085040763 11:73325027-73325049 AAGGTGGAGAGATGGGCCACGGG + Intronic
1085417100 11:76326360-76326382 GGGAAGCAGACGTGGGCCAGGGG - Intergenic
1086249274 11:84794845-84794867 AGGATGCCGAGGTGGGGCTGAGG + Intronic
1086399272 11:86447409-86447431 AGGGACCTGAGGTGGACCAGTGG - Intronic
1086597455 11:88590537-88590559 ATGGTGCAGACGTGGGAGAGGGG - Intronic
1086927224 11:92653354-92653376 AGGCAGCAGATGTGGGCCACTGG - Intronic
1086952085 11:92901055-92901077 AGGGTGTGGAGCTGGCCCAGTGG + Intergenic
1088893988 11:114064247-114064269 TGGGTGCTCAGGTCGGCCAGTGG - Exonic
1090234719 11:125139137-125139159 GGGGTGCAGCGGGGGGCCTGAGG - Intergenic
1090404118 11:126467024-126467046 TGTGTGCAGATATGGGCCAGGGG + Intronic
1090805167 11:130198081-130198103 AGGGTGGGGAGTGGGGCCAGAGG - Intronic
1091112941 11:132987461-132987483 AGGATGCAGAGGTAAGCTAGTGG + Intronic
1091310423 11:134571467-134571489 AGGAAACAAAGGTGGGCCAGAGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1092239861 12:6829779-6829801 AGGGTGGGGAGGCTGGCCAGGGG + Intronic
1092701566 12:11237133-11237155 AGGGTGAGGAGGTGGGAGAGAGG - Intergenic
1093755838 12:22850913-22850935 AGTGGGCAGGGGTGGGCCACAGG + Intergenic
1094368062 12:29705224-29705246 CGGGTGCACAGGTGGCCCATCGG + Intronic
1094411015 12:30169206-30169228 AGGGAGCAAAGGTGGGCGTGGGG + Intergenic
1095409838 12:41909516-41909538 AGGCTGCAGAGGTGGAAAAGTGG - Intergenic
1095892186 12:47245191-47245213 ATTGTGAAGAGATGGGCCAGGGG - Intergenic
1096836561 12:54354969-54354991 AGGGTTCTGAGGTGGGACTGAGG + Intergenic
1096944675 12:55391939-55391961 AGGATGGAGAGGATGGCCAGAGG - Intergenic
1097247342 12:57613843-57613865 AGGCTTGAGAGGTGGGACAGAGG - Intronic
1098160989 12:67648511-67648533 AGGGGGCGGAGGAGGGCGAGCGG + Intronic
1100980337 12:100157961-100157983 AGGCAGCAAAGGTGGGGCAGGGG + Intergenic
1101876325 12:108598752-108598774 AGGGTCCTGAGGTGAGTCAGTGG + Intergenic
1101995766 12:109523885-109523907 AGGGTGCAGACATGGCCCAGGGG - Intronic
1102571279 12:113828517-113828539 CGGGGGCACAGGTGGGCGAGGGG + Intronic
1103885567 12:124197732-124197754 AGGGGCCAGAGGTTGGCCTGGGG + Intronic
1104108874 12:125687824-125687846 AGGGTGCAGAGGAAGGCAAGGGG + Intergenic
1105016323 12:132788125-132788147 GGGGTGGGGAGGTGGGCCAAGGG - Intronic
1105205712 13:18221815-18221837 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1105469334 13:20678320-20678342 AGGGTGCAGAGTGGGACCAGGGG + Intronic
1106449983 13:29872271-29872293 AGGGAGCAGAGGAGGACAAGAGG + Intergenic
1107892318 13:44924988-44925010 AGGCTGCAGAGGTGGGGAGGTGG - Intergenic
1108066315 13:46581249-46581271 AGGGGGCTGAGGTGAGGCAGAGG - Intronic
1109210450 13:59529304-59529326 AGGCTGCAGAGGGGTGCCAATGG + Intergenic
1110305998 13:73987597-73987619 AGGGAGCAGACGTGGGAGAGGGG + Intronic
1110390918 13:74972952-74972974 AGGAGGCTGGGGTGGGCCAGAGG - Intergenic
1112190794 13:97175420-97175442 CGGGTGCAAAGATGGGCCTGGGG + Intergenic
1112341995 13:98560268-98560290 AAGGTGCATAAGTGGGTCAGGGG - Intronic
1113447172 13:110378430-110378452 ATGGTCCAGAGGTGCGCCTGCGG + Intronic
1113614690 13:111671797-111671819 AGAGCACAGAGCTGGGCCAGTGG + Intronic
1113620159 13:111756711-111756733 AGAGCACAGAGCTGGGCCAGTGG + Intergenic
1113707903 13:112446028-112446050 AGTGGTCAGAGGTGGGGCAGGGG + Intergenic
1114493760 14:23119007-23119029 AGGGGGCCGAGCTGGGCCCGGGG - Exonic
1116410097 14:44610753-44610775 AGGGTGCTGAGGTTAGACAGGGG - Intergenic
1117182214 14:53202486-53202508 AGGGAGCAGTGGTGTGCCTGTGG - Intergenic
1117460755 14:55942605-55942627 GGGGTGCAGAAGTGGGGGAGTGG - Intergenic
1118869343 14:69728074-69728096 AGGCAGAAGAGATGGGCCAGGGG + Intronic
1118992664 14:70809808-70809830 AGGGAGCTGCGGCGGGCCAGTGG - Intergenic
1119050563 14:71364358-71364380 AGGGTGCAGGGGTTGGGGAGGGG - Intronic
1119998671 14:79279433-79279455 AGGCTGCAGAGGTGGCCGAGAGG - Intronic
1121431419 14:93891028-93891050 GGGGTGCAGAGGTGGACAGGCGG - Intergenic
1121577612 14:95001214-95001236 AAGGGGCAGCGGTGGGCCATGGG + Intergenic
1121600172 14:95197526-95197548 AGGGTGCAAAGGTGGCCTATAGG + Intronic
1121887289 14:97555303-97555325 AGGGTACATGGGTGGGGCAGTGG - Intergenic
1121898295 14:97669498-97669520 AGGTTGGATAGGTGGGCCACTGG - Intergenic
1122291188 14:100681277-100681299 AGGGGGCATGGGTGGGGCAGTGG + Intergenic
1122324517 14:100874597-100874619 AGGGTGCAGAGGAGGGTCCGGGG - Intergenic
1122438849 14:101716623-101716645 GAGGTGCAGAGATGGGTCAGGGG - Intergenic
1122606205 14:102948600-102948622 TGGGTGCAGAGGTGGGGGGGTGG + Intronic
1122835425 14:104428413-104428435 CGGGGGCAGGGGTGGGCCAATGG + Intergenic
1122836895 14:104434913-104434935 AGGGTGCAAGGGAGGGCCAGGGG + Intergenic
1122847927 14:104510870-104510892 AGAGTGCAGGGGTGGGGCAGTGG + Intronic
1122890108 14:104728285-104728307 ACAGTGCAGAGGTGGGGTAGGGG - Intronic
1123195705 14:106614427-106614449 AGGCTGCACAGGTGAGGCAGAGG + Intergenic
1124720368 15:32106193-32106215 GGGGTGCAAATGTGGGCCGGGGG + Intronic
1125366443 15:38921366-38921388 GGGGTGCAGGGGTGGGGCAAGGG + Intergenic
1125834111 15:42735900-42735922 AGGGTGCAGAAGTCTGCAAGAGG - Exonic
1126693817 15:51309022-51309044 AGGCAGCAGAGGTGGGCTGGGGG + Intronic
1127053908 15:55112931-55112953 ATGGAGCAGAGGTAGGCCATGGG - Intergenic
1127699140 15:61480102-61480124 AAGGTTCAAAGGTGGGACAGTGG + Intergenic
1128052736 15:64677912-64677934 TGGGTGCAGAGGTGGGGGCGGGG + Intronic
1128439956 15:67697118-67697140 AGGGTGAAGAAGTGGGGAAGAGG + Intronic
1128530827 15:68446415-68446437 AGTGAGGAGAGGTGTGCCAGGGG - Intergenic
1128704073 15:69825874-69825896 AGGGGGAAGTGGTGGGGCAGGGG - Intergenic
1128838673 15:70832107-70832129 GGGGTGCTGAGGTTGCCCAGGGG - Exonic
1129028813 15:72604303-72604325 GGGATGGAGAGGAGGGCCAGGGG + Intergenic
1129231056 15:74197432-74197454 AGAGTGCAGAGGAGGGCTTGGGG + Intronic
1129238189 15:74236358-74236380 ACGGTGGAGAGATGGGGCAGGGG - Exonic
1129250172 15:74304392-74304414 AGGGAGGAGAAGTGGGTCAGGGG - Intronic
1129727970 15:77911272-77911294 AGGCAGCTGAGGTGGGACAGTGG - Intergenic
1129822881 15:78616686-78616708 ATGGAGCAGAGGAGGGCCCGGGG - Intronic
1130213201 15:81945204-81945226 AAGGTGCAGAGGTGGGAGAGGGG - Intergenic
1130312419 15:82767025-82767047 AGGCTGCAGCTCTGGGCCAGAGG + Intronic
1130782106 15:87051125-87051147 AAGGGGAAGAGGTGGGGCAGTGG + Intergenic
1131282388 15:91032360-91032382 AGGCAGCAAAGGTGGGGCAGTGG + Intergenic
1131665644 15:94568516-94568538 AGGAGGAAGAGGTGGGGCAGAGG + Intergenic
1132002660 15:98195623-98195645 AGCTTGGTGAGGTGGGCCAGGGG + Intergenic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132647282 16:1004908-1004930 AGGGAGCAGAGATGGGGGAGGGG + Intergenic
1132647302 16:1004971-1004993 AGGGTGTAGAGATGGGGGAGGGG + Intergenic
1132647344 16:1005087-1005109 AGGGAGCAGAGATGGGGGAGGGG + Intergenic
1132804468 16:1769218-1769240 AGCATGCAGAGGTGGGCCCAGGG - Exonic
1132857404 16:2052855-2052877 AGGCAGCAGAGGTCGGGCAGGGG + Intronic
1132863032 16:2080834-2080856 AGGTGGCTGAGGTGGGGCAGGGG + Intronic
1132889675 16:2197357-2197379 AGTGGGCAGACGTGGGCCGGGGG - Intergenic
1133046189 16:3089605-3089627 TGGGTGCAGTGGTGGGGCCGAGG + Exonic
1133128494 16:3662252-3662274 AGGGAGCAGCGCTGGTCCAGGGG - Exonic
1133229722 16:4360782-4360804 AGTGAGGAGAGGGGGGCCAGTGG - Intronic
1133234400 16:4381169-4381191 AGGTTGCTGAGGTTGGCGAGTGG - Exonic
1133818021 16:9212974-9212996 GGGGTGCAGAGATGGGGCAGTGG + Intergenic
1134506738 16:14813774-14813796 GGGGTGCTTAGGTGGGGCAGGGG + Intronic
1134573820 16:15315047-15315069 GGGGTGCTTAGGTGGGGCAGTGG - Intergenic
1134728600 16:16441271-16441293 GGGGTGCTTAGGTGGGGCAGGGG + Intergenic
1134938842 16:18270647-18270669 GGGGTGCTTAGGTGGGGCAGGGG - Intergenic
1135757498 16:25110053-25110075 AGGGTGGAGAGCTTTGCCAGGGG - Intergenic
1136506897 16:30710152-30710174 AGGGTTCAGAGGGGGAACAGAGG + Intronic
1136624072 16:31451010-31451032 AGGGTGAAGAGGTGGGGATGTGG - Intergenic
1137446171 16:48533913-48533935 AGGGTGCACATGGAGGCCAGAGG + Intergenic
1137749058 16:50845238-50845260 TGGGTACAGAAGGGGGCCAGAGG + Intergenic
1137837402 16:51606114-51606136 AAGGTGCAGATGTTGGCCATTGG - Intergenic
1138165636 16:54799115-54799137 AAGGGGCATAGGTGGGCCTGAGG + Intergenic
1138396040 16:56705510-56705532 AGGGTGGAGAGTGGGGTCAGGGG + Intronic
1138950439 16:61906381-61906403 AGGCTGCAGTGGGTGGCCAGAGG - Intronic
1139508349 16:67411067-67411089 TGGGAGCAGAGGTGGGCAGGAGG - Intronic
1139689359 16:68630027-68630049 TGGGAGCAGAGGTGGGGTAGTGG + Intergenic
1139700109 16:68703062-68703084 TGGGGACAGAGATGGGCCAGCGG + Intronic
1139820616 16:69718286-69718308 AGGGGCCAAAGCTGGGCCAGAGG + Intronic
1139922853 16:70470742-70470764 AGGGTTCAGAGGTGGCCCCCAGG + Intronic
1139971377 16:70777691-70777713 AAGATGCGGAGGTGGGGCAGGGG + Intronic
1141028785 16:80570694-80570716 AGGGTGGAGAGGTGGGGGTGGGG - Intergenic
1142002011 16:87669566-87669588 GGAGTGCAGACGTGGGTCAGTGG + Intronic
1142158802 16:88546804-88546826 AAGGTGCAGAGATGGGCGATGGG - Intergenic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261086 16:89042705-89042727 AGGGTGCAGCGATGGGCGTGGGG + Intergenic
1143176124 17:4956181-4956203 AGTGGGCAGAGCTGGGGCAGAGG - Intronic
1143404461 17:6667957-6667979 GGTGTGCAGGGGTGGGCAAGAGG - Intergenic
1143514811 17:7414310-7414332 GGGGTGGGCAGGTGGGCCAGGGG - Intronic
1143655186 17:8289687-8289709 AGGAAGCAGGAGTGGGCCAGAGG + Intronic
1143749865 17:9020819-9020841 AGGGAGCAGTGGTGGGCAGGAGG - Intergenic
1143953743 17:10653404-10653426 AGGGGGAAGAGGTGGGCCGGGGG - Intronic
1144834845 17:18151381-18151403 AGGGTGAAGCTGTGGGCAAGGGG - Exonic
1145242814 17:21249550-21249572 GGGGTGCTGAGGGAGGCCAGGGG + Intronic
1145823093 17:27855518-27855540 AGGGTGGTGAGTTGGGCAAGAGG + Intronic
1146169253 17:30620794-30620816 AGGGTGCAGAGCAGAGCCTGGGG + Intergenic
1146170309 17:30626655-30626677 AGGGTGCAGAGCAGAGCCTGGGG - Intergenic
1146343763 17:32042685-32042707 AGGGTGCAGAGCAGAGCCTGGGG - Intronic
1146379603 17:32319018-32319040 AGGGTGCAGTGGGGTGGCAGTGG + Intronic
1146692944 17:34889307-34889329 AGGGAGCAGAGGTAAGCCTGGGG - Intergenic
1146694052 17:34895676-34895698 TGTGTGGAGAGGAGGGCCAGCGG + Intergenic
1147177240 17:38663560-38663582 AGGGTGGAGAGGAGGGAGAGAGG - Intergenic
1147363588 17:39946143-39946165 AGGGTGCAAAGAGGGGCAAGGGG + Intergenic
1147383381 17:40068721-40068743 AGGAGGAGGAGGTGGGCCAGGGG - Intronic
1147766910 17:42843138-42843160 AGGGTGAGGAGGAGGGGCAGTGG - Exonic
1148061286 17:44838348-44838370 GGGGGGCAGCGGTGGGGCAGGGG - Intergenic
1148723892 17:49775009-49775031 AGGCAACAGAGGGGGGCCAGAGG - Intronic
1148798065 17:50206944-50206966 TGGGTGGAGAGGTGGGACAACGG - Intergenic
1149454561 17:56777402-56777424 AGCTTGCAGAGATGGGGCAGGGG - Intergenic
1149651070 17:58276754-58276776 AGGAGGCAGAGGGAGGCCAGAGG + Intronic
1150327862 17:64271182-64271204 AGGGTGCGGGGATGGGGCAGAGG - Intergenic
1150662943 17:67101261-67101283 GGTGTGTAGAGGTGGGACAGAGG + Intronic
1150782190 17:68133344-68133366 AGGGTGCAGAGCAGAGCCTGGGG + Intergenic
1151436215 17:74099462-74099484 AGGGTGCAGAGATGGTCTGGGGG - Intergenic
1151578383 17:74963990-74964012 AGGCTGCAGAGGAGGGTCAGGGG + Intronic
1151578391 17:74964021-74964043 AGGCTGCAGAGGAGAGACAGTGG + Intronic
1151661465 17:75521361-75521383 AGGCTGAGGAGGTGGGTCAGTGG + Intronic
1151748291 17:76023180-76023202 AGGGTGTAGGGGTGGCTCAGGGG - Intronic
1151819953 17:76492008-76492030 TGGGTGCGGAGGCGGGCCTGGGG - Intronic
1151954213 17:77372699-77372721 AGGGTGCAGCGGTGGCCCCCGGG + Intronic
1152068472 17:78124031-78124053 ACAGTGGAGAGGTAGGCCAGGGG + Exonic
1152301054 17:79495505-79495527 AGGGTGGGGAGGTGGGGGAGGGG + Intronic
1152460011 17:80437549-80437571 GGGGTGCAGGTGTGTGCCAGGGG + Exonic
1152621802 17:81368582-81368604 AGGGTACAGAGGGGTGGCAGAGG + Intergenic
1154314155 18:13290901-13290923 ACGGTGCAGAGCAGGGCCTGCGG - Intronic
1154338043 18:13481705-13481727 AGGGTCCTGAGCTGGGCCTGAGG + Intronic
1155053191 18:22165621-22165643 ACGGCGCGGAGGTGGGCTAGCGG - Intergenic
1155519599 18:26656103-26656125 GGGGCGCAGAGGTGGGCGGGAGG - Intronic
1155634498 18:27936632-27936654 AGGATGCTGAGGTGGGACAGTGG - Intergenic
1156327171 18:36085223-36085245 AGGTGGCAGAGCTGGGCCTGAGG + Intergenic
1156462286 18:37327766-37327788 AGGGCACAGAGGTGGACAAGAGG - Intronic
1157282618 18:46356062-46356084 AAGGTGGAGATTTGGGCCAGGGG - Intronic
1158459043 18:57631843-57631865 TGGGTGGAGAGGTTAGCCAGAGG - Intergenic
1158689042 18:59643961-59643983 AGGCTCCAGAGGTGGGGGAGAGG - Intronic
1159799105 18:72874645-72874667 AGGGGGGCGAGGTGGGCCGGGGG + Intergenic
1159969553 18:74632509-74632531 AGGAGGCAGAGCAGGGCCAGGGG + Exonic
1160048706 18:75411542-75411564 AGATTGCAGAGGAGGGACAGAGG + Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160754706 19:751307-751329 AGGGTGACGGGGTGGGGCAGGGG - Intronic
1160793057 19:931858-931880 AGGGTGCCGTGGAGGGGCAGTGG + Intronic
1161411848 19:4122001-4122023 AGGGTGCCAAGGTGGGGCAGGGG - Intronic
1161426702 19:4207712-4207734 TGGGTGCTGAGGTGGGCATGGGG + Intronic
1161842911 19:6693561-6693583 GGGGTGCAGAGAGGGGACAGGGG + Intronic
1162029141 19:7909886-7909908 AGCATGGAGAGGTGAGCCAGGGG + Exonic
1162550030 19:11353596-11353618 CGGGTTCAGAGGAGGGTCAGGGG - Intronic
1163497539 19:17655521-17655543 GGGGCACTGAGGTGGGCCAGGGG - Intronic
1163571237 19:18083599-18083621 AGGGTGCATAGATGGGAAAGTGG - Intronic
1163620881 19:18359327-18359349 GGGGTGGAGAGGCGGGCCAAGGG - Intronic
1164156777 19:22602051-22602073 AGGGGGCAAAGGTGGGGCAGGGG - Intergenic
1164788963 19:30959766-30959788 AAGGTGCAGGGATGGGCCTGTGG + Intergenic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165348005 19:35261088-35261110 TGGGTGCAGAGCTGGGCCTGTGG + Intronic
1165394733 19:35558091-35558113 AGGGTGCGGAGTTGGGCTGGGGG + Intronic
1165936136 19:39390193-39390215 TGGGAGCAGAGGTGGGGCAGCGG - Intronic
1165999791 19:39871131-39871153 AGGGGTCAGAGTTGGGACAGGGG + Intronic
1166001032 19:39877630-39877652 GGGGAGCAGAGGTGGGGCGGGGG - Intronic
1166007919 19:39919765-39919787 AGGGTTCAGAGCTGGGATAGTGG + Intronic
1166105136 19:40594438-40594460 AAGTTGCAGTGGTGAGCCAGAGG + Intronic
1166326465 19:42053935-42053957 AGGGTGGGGAGGTGGGGCAGAGG + Intronic
1166326964 19:42056892-42056914 TGGGGGCAGAGATGGGCCAGAGG + Intronic
1166380018 19:42350943-42350965 AGGATCCAGAGGTGGGCAAGGGG - Intronic
1166763018 19:45236119-45236141 AGGTTGGAGAGGTGGGGGAGGGG + Intronic
1166786508 19:45370414-45370436 AGGGTGAAGGGGTGGGACGGGGG - Intronic
1166856764 19:45786111-45786133 AGGGTGCGGGTGCGGGCCAGGGG + Exonic
1166859315 19:45800609-45800631 AGGGTGCAGTGCAGGGCCTGGGG - Intronic
1167052716 19:47089561-47089583 AAGGTTCAGAGGTGTGGCAGTGG + Intronic
1167281641 19:48572696-48572718 TGGGAGCAGAGGAGGGGCAGCGG + Intronic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167432552 19:49462745-49462767 AGGGTGCACAGGTGAGGCAGGGG + Exonic
1167440634 19:49506772-49506794 AGGGTGGAGAGGAGGGGCAGCGG + Intergenic
1167513682 19:49910399-49910421 AGAGTGCAGGTGTGGGCCTGGGG - Intronic
1167622193 19:50566575-50566597 GGGGTGGAGGGGTGGGCAAGAGG + Intronic
1168141563 19:54391443-54391465 AAAGTGCAGCGGTGGTCCAGGGG + Intergenic
1168191051 19:54739178-54739200 AGGGTGGAGATCTGGGCCTGGGG + Intronic
1168725344 19:58578191-58578213 GGGGTCCAGGGGTTGGCCAGAGG + Intergenic
925275463 2:2645147-2645169 AGGGTGGACAGGGTGGCCAGAGG - Intergenic
925990705 2:9251850-9251872 ATGGAGCAGAGATGGGCCTGAGG + Intronic
926344237 2:11930885-11930907 AGGGGACAGAGGTGGCCCTGGGG - Intergenic
928133047 2:28667212-28667234 AGGGTCCAGATGTGGGACACAGG - Intergenic
928171097 2:29003468-29003490 TGGGAGCAGAGGCGGGACAGGGG - Intronic
928171866 2:29009518-29009540 AGGATGCAGAGGTGGGGGCGGGG + Intronic
929070738 2:38028650-38028672 AGCGGGCAGAGCTGGACCAGAGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
931694192 2:64859767-64859789 AGGGGGCAGAGGTGTCCCGGCGG + Intergenic
932347320 2:71004204-71004226 CAGGTGGAGAGGTGGGCAAGTGG - Intergenic
935289921 2:101601450-101601472 AGAGAGCAGAGGTGGGCAAGGGG - Intergenic
936095850 2:109529528-109529550 AGGGTGCTGAGGAGGTCCTGAGG + Intergenic
936267415 2:111021171-111021193 AGGGTAGAGGAGTGGGCCAGTGG + Intronic
937020095 2:118642439-118642461 AGGGTGCTGTGGAAGGCCAGAGG - Intergenic
937297008 2:120815572-120815594 AGGCTAGAGAGGTGGGCCAGGGG - Intronic
937304459 2:120862617-120862639 AGGGTGCTGAGCTGGGCAGGTGG + Intronic
937343059 2:121104251-121104273 AGGGTGCAGGAGTGGGCGAGAGG + Intergenic
939402663 2:141714695-141714717 AGGGTTCAGAGTTGGAACAGAGG + Intronic
941471753 2:165896940-165896962 TGGGTGCAGAGCTGGGCAAAAGG - Intronic
943209004 2:184938623-184938645 AGGCTGCAGAGGTGTGCTAGGGG - Exonic
944403930 2:199360909-199360931 AGGGTGCAGTGGAGGGGCAGGGG - Intronic
945158019 2:206859688-206859710 AGAGTGGAGAAGTGGGCCATGGG - Intergenic
946024186 2:216661930-216661952 AGGGAGTAGAGGTGCTCCAGAGG - Exonic
946923635 2:224604150-224604172 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
947047908 2:226008996-226009018 AGGCTGGAGACGTTGGCCAGGGG + Intergenic
947743243 2:232494567-232494589 AGTGGGTAGAGGTGGGGCAGAGG - Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
947800500 2:232926630-232926652 TGGGAGCAGAGTTGGGCTAGAGG - Intronic
948032012 2:234826564-234826586 GGGGTGGAGAGGAGGACCAGGGG - Intergenic
948113630 2:235477184-235477206 AGGGTGCAGAGGGCGCTCAGTGG + Intergenic
948363620 2:237439883-237439905 AAGGTGCTGAGGAGGGGCAGAGG - Intergenic
948876320 2:240831724-240831746 GGGGTGCCGAGGTGGGCAAAGGG + Intergenic
1168743354 20:213976-213998 AGGGTGCATAGGAGCGGCAGTGG - Intergenic
1169408351 20:5345173-5345195 AGGCTGCAGAGTTGGGTAAGAGG + Intergenic
1170329374 20:15191438-15191460 ATAGTGAAGAGGTGGGCCAAAGG + Intronic
1172408005 20:34703849-34703871 AGGCTGAGGAGGTGAGCCAGAGG + Intronic
1172670570 20:36632236-36632258 GTGGTGCTGGGGTGGGCCAGTGG - Intronic
1172870025 20:38130052-38130074 AGGAGGCTGAGATGGGCCAGGGG + Exonic
1172963239 20:38813600-38813622 AGGGTGCAGAGCTTGGCAAGTGG - Intronic
1173057782 20:39632931-39632953 AGGGTGCAGAGCTGAGCCCAAGG + Intergenic
1173184659 20:40831292-40831314 AGGCCCCAGAGGTGGGTCAGGGG - Intergenic
1173586548 20:44187146-44187168 GGGGTGGAGAAGGGGGCCAGCGG - Exonic
1173947302 20:46961869-46961891 ATGGTGCAGGGGTGAACCAGAGG + Intronic
1174118836 20:48247246-48247268 GGGCTGCAGAGGTGGGTGAGAGG + Intergenic
1174162949 20:48564511-48564533 ACGGTGCAGAGGTGGGCTGAAGG + Intergenic
1174258621 20:49277673-49277695 GGGGCGCTGAGATGGGCCAGGGG + Intronic
1174774466 20:53331429-53331451 AGGGAGCACAGCCGGGCCAGGGG + Intronic
1174846777 20:53950206-53950228 AGGGTGGAGAGGTAGGGTAGGGG - Intronic
1175382147 20:58570742-58570764 AGCGTTCAGGGGAGGGCCAGAGG + Intergenic
1175402581 20:58708860-58708882 CGGGGGCAGGGGTGGGCAAGTGG + Intronic
1175582412 20:60110923-60110945 AGGGTGCTGAGGAGGGGTAGAGG + Intergenic
1175586934 20:60148614-60148636 AGGGTGGAGAGTGAGGCCAGGGG + Intergenic
1175810630 20:61855473-61855495 AGGGTGCAGATGTGGAGGAGTGG + Intronic
1176167718 20:63682723-63682745 TGGGGGCAGAGTGGGGCCAGTGG + Intronic
1176235154 20:64050445-64050467 AGGGTCCAGGGAGGGGCCAGTGG - Intronic
1178601749 21:34000493-34000515 GGGGTGTAGAGGTGAGCCAGGGG + Intergenic
1179454664 21:41490839-41490861 AAGGTGCAGAGGTGGAGGAGAGG + Intronic
1180225094 21:46387474-46387496 GGGGTGCAGAGGTGAGCCCACGG + Intronic
1180254017 21:46610195-46610217 AGTGTGCAGTGGTCGGCCACTGG - Intergenic
1180760256 22:18196901-18196923 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1180770568 22:18381199-18381221 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1180808482 22:18738850-18738872 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1180828511 22:18884157-18884179 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1180995530 22:19963427-19963449 GGTGGGCAGAGGAGGGCCAGCGG + Intronic
1180995765 22:19964480-19964502 TGGGTGGGGAGCTGGGCCAGGGG + Intronic
1181071412 22:20343814-20343836 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1181194484 22:21172764-21172786 GGGGTGCAGAGGAGGGGCTGTGG - Intergenic
1181214958 22:21320014-21320036 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1181433079 22:22894663-22894685 AGGCTGCTGGGGTGGGCCTGGGG + Intronic
1181464029 22:23101299-23101321 ATGGTGAAGAGGGGGGCCACTGG - Intronic
1182147460 22:28005512-28005534 AGGGTGCTGAGCTGTGTCAGTGG + Intronic
1182298838 22:29326969-29326991 AGAGGTCAGAGGTGGGGCAGTGG + Intergenic
1182981279 22:34673765-34673787 AGTGGGCAGAGGTTGGTCAGGGG + Intergenic
1183364375 22:37399475-37399497 AGGTGGGAGAGGTGGGCCGGTGG - Intronic
1183364404 22:37399553-37399575 AGGTGGGAGAGGTGGGCCGGTGG - Intronic
1183955081 22:41375022-41375044 AGGGGACAGAGGTGGGCCTCTGG - Intronic
1184116649 22:42426397-42426419 AGGGTGCCGAGAAGAGCCAGAGG - Intronic
1184886064 22:47345120-47345142 AGATTCCAGAGGTGGCCCAGCGG + Intergenic
1185098511 22:48825068-48825090 AGGGTTCTCAGGTGGGGCAGGGG + Intronic
1185226634 22:49657214-49657236 AGCGGGCAGAGATGGGGCAGAGG - Exonic
1185249838 22:49795360-49795382 GGAGTGCACAGGTGAGCCAGTGG - Intronic
1185399421 22:50608250-50608272 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399435 22:50608307-50608329 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399452 22:50608364-50608386 GGGGTGGAAAGGTGGGACAGTGG + Intronic
1185399480 22:50608473-50608495 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399497 22:50608530-50608552 GGGGTGGAGAGGTGGGACAGTGG + Intronic
1185399526 22:50608639-50608661 GGGGTGGAGAGGTGGGACAGCGG + Intronic
1185399541 22:50608696-50608718 GGGGTGGAGAGGTGGGACAGTGG + Intronic
1203232403 22_KI270731v1_random:122371-122393 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
1203278605 22_KI270734v1_random:110146-110168 GGGGTGCAGAGGAGGGGCTGTGG + Intergenic
950207518 3:11092161-11092183 AGAGGGCAGAGCTGGGCCTGGGG + Intergenic
950453037 3:13076193-13076215 AGCCTGCAGAGGTGGGTGAGTGG - Intergenic
950555883 3:13695761-13695783 AGGATGCACAGGGGCGCCAGTGG - Intergenic
958025064 3:88040175-88040197 AGGGGGCTGTGGTGGGCCAAAGG + Intergenic
958259092 3:91358718-91358740 TGGGTGTGGAGGTGGGACAGAGG - Intergenic
958936552 3:100261502-100261524 AGGGTTCAGAGGTTGACCCGAGG + Intronic
960720036 3:120616656-120616678 AGGGTGCTCAGGTGGGGCACAGG - Intergenic
961367472 3:126409216-126409238 AGGCTGGAGAGGAGAGCCAGTGG - Intronic
961755026 3:129122172-129122194 GGTGTGCTGAGGTGGGCCTGAGG - Intronic
962578099 3:136772974-136772996 AGGGTGCAGACGGGGTGCAGGGG + Intergenic
962873559 3:139518806-139518828 AAGGTGGAGAGGAGGGCCTGAGG + Intronic
963236859 3:142964077-142964099 AGGGCGGAGAGATGCGCCAGCGG + Intergenic
963639470 3:147840459-147840481 ATAATGGAGAGGTGGGCCAGAGG - Intergenic
965310123 3:167116553-167116575 AGGAGGCACAGCTGGGCCAGGGG - Intergenic
966791860 3:183678939-183678961 AGAGAGCAGAGTTGGGCCAAAGG + Intronic
967197628 3:187042509-187042531 AGGCTGCAGAGGTGGCCAGGAGG + Intronic
968525104 4:1052787-1052809 GGTGTGCTGAGGTGGGCCAGTGG + Intergenic
968706783 4:2082246-2082268 AGAGTGCAGAGTGTGGCCAGGGG - Intronic
969416765 4:7065654-7065676 AGGGATCAGAGGTGGGACAATGG + Intronic
969694002 4:8724758-8724780 AGGGAGGAGGGGCGGGCCAGCGG - Intergenic
970676758 4:18459293-18459315 AGTGTGCAGAGGCTGGCTAGAGG + Intergenic
970997197 4:22280888-22280910 AATGTGCAGTGGTGGGGCAGGGG + Intergenic
971330383 4:25676805-25676827 AGGGTGCAGAAGTGGGAGGGAGG - Exonic
972602108 4:40581945-40581967 TGGGTGCAGAGGAGGGGAAGCGG - Intronic
975699369 4:77048234-77048256 AGGCTGCAAAGGTGGACAAGGGG + Exonic
977059069 4:92233782-92233804 AGGGTGGAGGGGAGGGACAGGGG + Intergenic
979899783 4:126201738-126201760 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
981677059 4:147354443-147354465 AGAGTGCAGAGGCGGGAAAGGGG - Intergenic
982083148 4:151809566-151809588 AGTGTGCTGAGGTGGCCCTGGGG - Intergenic
982241958 4:153308845-153308867 AGTTTGCAGAGGTGGGGCAGGGG - Intronic
984255231 4:177382216-177382238 AGGAGGCAGAGCTGGGCCTGGGG - Intergenic
984730511 4:183064133-183064155 AGGGTGCAGAGATGGGGTTGAGG - Intergenic
985801138 5:2005880-2005902 AAGGCACAGAGGTGAGCCAGCGG - Intergenic
985819564 5:2150391-2150413 AGGGGGCACAGATGGGCCATCGG - Intergenic
985887019 5:2687666-2687688 TAGGTGAAGAGATGGGCCAGAGG - Intergenic
985988770 5:3538469-3538491 AGGATGCAGGGGTGGGGCTGTGG - Intergenic
986195272 5:5532517-5532539 GGGCTGTAGAGGTGGGCCTGGGG - Intergenic
986242391 5:5972806-5972828 ATGGTGCAGAGGTGGGGCCAGGG - Intergenic
986741681 5:10710584-10710606 AGGGTGCAGAGGAAGGCACGAGG + Intronic
988721553 5:33884151-33884173 AGGGAGCAGAGGTTTCCCAGTGG - Intronic
991093203 5:62712629-62712651 AGGAGGCTGAGGTGGGCCAACGG - Intergenic
991281820 5:64923170-64923192 AAAGTGCTGAGGTGGGGCAGTGG + Intronic
992380329 5:76229800-76229822 AGGGTGAAGAGGTTGGGGAGAGG + Intronic
993476859 5:88376965-88376987 ATGGTGCAGGGGTGAGGCAGAGG - Intergenic
995410186 5:111848540-111848562 ACAGTGCAGTGTTGGGCCAGTGG + Intronic
996344166 5:122471791-122471813 AGGGTGAGGAGGAGGGTCAGGGG - Intergenic
997039655 5:130236469-130236491 AGGATGCAGATTTGGGACAGAGG + Intergenic
997368724 5:133342322-133342344 AGGTTGCAGAGAAGGGGCAGGGG + Intronic
997476674 5:134146450-134146472 AGGGTGCTGCGGGGGGCCTGTGG - Exonic
997847198 5:137297656-137297678 AGGGTGGGGAGGTGGGACAAAGG + Intronic
998162478 5:139821447-139821469 AGGGGCCAGAGTTGGGCCTGGGG + Intronic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
998554097 5:143106287-143106309 AGGCTGCAGAGATGGGCAGGAGG + Intronic
999200614 5:149813622-149813644 AAGGTGCAGCGGATGGCCAGTGG - Intronic
999300621 5:150487928-150487950 AGGGGGCAGAGGTAGGGCAAGGG + Intronic
1001187046 5:169584062-169584084 AGGGCGGCGAGGTGGTCCAGCGG - Intronic
1001279834 5:170378798-170378820 AGGGAGAAGAGGAGGGCCTGGGG + Exonic
1001336903 5:170806041-170806063 AGGCTTCAGAGCTGGTCCAGAGG - Intronic
1001379295 5:171292963-171292985 AGAGAAGAGAGGTGGGCCAGAGG - Intronic
1001573093 5:172743674-172743696 AAGGGGCACAGGTGGTCCAGAGG + Intergenic
1002175287 5:177398128-177398150 CGGGTGATGAGGTGGTCCAGGGG - Exonic
1002877810 6:1226767-1226789 AGGCTGCCGGGGTGGGCCATGGG + Intergenic
1003770224 6:9290883-9290905 AGGGTGCAGCGGTGGGCTGAAGG + Intergenic
1004235605 6:13872369-13872391 AGGGTGCAGTGGTGGGCTGAAGG + Intergenic
1004434952 6:15581876-15581898 AGTGTGCAGAGGGGAGCTAGAGG + Intronic
1004521746 6:16367249-16367271 AGGGGGCAGAGATGGGAAAGGGG + Intronic
1004610157 6:17232243-17232265 AGGGTGCAGAGGGTAGGCAGGGG + Intergenic
1005709420 6:28489548-28489570 GGGGTGCGGAGGTGGGGGAGGGG + Intergenic
1005943324 6:30577718-30577740 AGGGTGGAGTGGAGGGCCAGTGG + Intronic
1006147329 6:31967487-31967509 AGGGTGAAAAGGAGGGCAAGAGG - Intronic
1006237358 6:32645596-32645618 AAGGTGCAGAGGTATCCCAGAGG - Intronic
1006249036 6:32765123-32765145 AGGAAGAAGGGGTGGGCCAGAGG - Intergenic
1006878471 6:37318642-37318664 AGGGAGCAGAGGTGGCTGAGAGG + Intronic
1007283906 6:40733841-40733863 AGGCTGCAGAGGTGGGCAGGAGG - Intergenic
1007372073 6:41432530-41432552 AGGAGGCTGGGGTGGGCCAGGGG - Intergenic
1007391372 6:41551391-41551413 AAGGTGCAGGGCTGTGCCAGAGG - Intronic
1008497363 6:52146515-52146537 AAGGAGCAGAGGTTAGCCAGAGG + Intergenic
1008637866 6:53430020-53430042 AGTAGGGAGAGGTGGGCCAGAGG + Intergenic
1008796215 6:55306250-55306272 AGGGTGTATTGGTGGGCCAAGGG - Intergenic
1008996166 6:57661873-57661895 TGGGTGTGGAGGTGGGACAGAGG + Intergenic
1009184693 6:60560652-60560674 TGGGTGTGGAGGTGGGACAGAGG + Intergenic
1009407161 6:63326901-63326923 ATAGTGCAGCGGTGGGCCAAAGG + Intergenic
1009940503 6:70283073-70283095 AGGCTGCAGAGCCGGGCCAAGGG - Intronic
1010926817 6:81753848-81753870 CGGGGGCTGAGGTGGGGCAGAGG + Intergenic
1011512862 6:88120505-88120527 AGGGAGCAGAGGTGGCTTAGAGG - Intergenic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1014243610 6:119043624-119043646 AAGGTGCCGAGGTGGGGCAGGGG - Intronic
1015235134 6:130962260-130962282 AGGCAGGAGAGGTGGGGCAGAGG + Intronic
1016686283 6:146885980-146886002 AGGGAGGAGAGGTGGGCAGGAGG - Intergenic
1017324659 6:153131263-153131285 AGGATGCAGAGGAGGGGGAGGGG + Intergenic
1017931511 6:158959447-158959469 AGGGTCCTGAGGTGGCCCTGGGG + Intergenic
1018718811 6:166556610-166556632 AGAGTACAGAGGTGGGCAACTGG + Intronic
1018917088 6:168140219-168140241 AGGGTGGGGTGGTGGGGCAGGGG - Intergenic
1018924985 6:168199551-168199573 TGGGTGGATAGGTGGGCGAGTGG + Intergenic
1019015321 6:168875891-168875913 GAGGTGCTGGGGTGGGCCAGGGG + Intergenic
1019282264 7:206427-206449 AGGGTGCAAAGGTGGGATGGGGG - Intronic
1019312941 7:371620-371642 AGGATGCAGAGGTGGGGCCGTGG + Intergenic
1019319804 7:410450-410472 AGGGTGCTGAGCTGTGCCACAGG + Intergenic
1019348959 7:544268-544290 AGCGTGCAGAGGTTGGCCTAGGG - Intergenic
1021320503 7:19204363-19204385 TGGTTGCAGGGGTAGGCCAGTGG + Intergenic
1021918106 7:25455691-25455713 AGGGGGCAGAGGTGGGCAGGAGG - Intergenic
1022030730 7:26489844-26489866 TGGTTGGAGAGGTGGGGCAGGGG + Intergenic
1022203141 7:28137312-28137334 AAGGGGCAGGGGTGGACCAGAGG + Intronic
1022225472 7:28358317-28358339 GGGGTCCACAGGTGGGACAGTGG - Intronic
1022482660 7:30753942-30753964 GGGGTGCAGAGGTTGGGGAGGGG + Intronic
1022757715 7:33311260-33311282 AGGCTGCTGAGGTGATCCAGGGG + Intronic
1023177438 7:37448112-37448134 AGGGGGCGGTGATGGGCCAGAGG - Intronic
1023375141 7:39548341-39548363 AGGTTTCAGAGGTGGGTAAGGGG - Intergenic
1024042128 7:45564006-45564028 AGGCAGCAGCGGTGGGCAAGGGG + Intergenic
1024520372 7:50300576-50300598 AGGATGCAGAGGAGAGGCAGGGG - Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1025943854 7:66091982-66092004 TGGGGGCACAGGTGGGCGAGTGG - Intronic
1026077547 7:67186268-67186290 AGGGGGGAGAGGTGGGGCGGGGG - Intronic
1026670437 7:72386098-72386120 AGGTTGAAGAGGTGGAGCAGAGG + Intronic
1026699318 7:72625879-72625901 AGGGGGGAGAGGTGGGGCGGGGG + Intronic
1029304296 7:99607414-99607436 AAGGTGCAGAGGTGAGCTAAGGG + Intronic
1029538345 7:101168854-101168876 AGGCTGCAGAGGTGAGTCACCGG - Intergenic
1029783723 7:102763863-102763885 AGGGTGCAAAGTTGGGCAGGAGG + Intronic
1030096621 7:105906435-105906457 AGGGTGCAGAGCTGTGCTTGAGG + Intronic
1031319719 7:120309198-120309220 TGGATGCAGAGGTGAGTCAGTGG - Intronic
1031823095 7:126528910-126528932 GGGGTACACAGGTGTGCCAGTGG - Intronic
1031972203 7:128073048-128073070 AGGGGGCAGAGGTATGGCAGTGG + Intronic
1031997525 7:128242360-128242382 AGGATTCTGAGGTGGGCCATGGG + Intronic
1033099728 7:138460198-138460220 CGGGGCCTGAGGTGGGCCAGGGG + Intergenic
1034383733 7:150720752-150720774 AGGGTGCAGAGGAGGCCATGGGG + Exonic
1034422034 7:150995560-150995582 AGGGTGCAGGGGTGGGAGGGGGG - Intronic
1034422178 7:150995913-150995935 AGGGTGCAGGGATGGGACAGGGG - Intronic
1034422228 7:150996045-150996067 GGGGTGCAGAGGTGGGGTAGGGG - Intronic
1034422254 7:150996111-150996133 GGGGTGCAGGGGTGGGGTAGGGG - Intronic
1034422280 7:150996176-150996198 AGGGTACAGGGGTGGGAGAGGGG - Intronic
1034422328 7:150996308-150996330 GGGGTGCAGGGGTGGAACAGGGG - Intronic
1034546641 7:151793887-151793909 AGGCAGCAGGGGAGGGCCAGTGG + Intronic
1035205507 7:157291666-157291688 AGGGTGCAGAGGGGGGTCGCAGG + Intergenic
1035999179 8:4582740-4582762 ACAGTGCAGCGGTGGGCCAAAGG - Intronic
1037341280 8:17848250-17848272 AGGCTTCATAGGTGGGCCTGGGG - Intergenic
1037888762 8:22610171-22610193 AATGTGCAGAGTGGGGCCAGGGG + Intronic
1038114306 8:24535564-24535586 AGAGTTCAGCAGTGGGCCAGAGG - Intergenic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1039476797 8:37843038-37843060 AGGGTTCAGAGGTGGCACACCGG + Exonic
1039637234 8:39180027-39180049 ACAGTGCAGCGGTGGGCCAAAGG - Intronic
1039793280 8:40892074-40892096 AGGGTGGAGTGGTGGCCCAGTGG - Intronic
1040597671 8:48855600-48855622 GTGGTGCAGAGCTGAGCCAGAGG + Intergenic
1041695543 8:60732394-60732416 AGGATGCAGAGGTGAGGCAAGGG - Intronic
1042782537 8:72508075-72508097 AGAGGGCAGAGATGTGCCAGAGG + Intergenic
1045259619 8:100560602-100560624 AGCCTGCAGGTGTGGGCCAGGGG - Intergenic
1045264724 8:100609340-100609362 AGGGTGCAGAGGAAGCACAGTGG - Intronic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1046647366 8:116800875-116800897 AGGGTTCAGAGGTGGGGCCAGGG + Intronic
1047253077 8:123195156-123195178 AGAGTGCAGAGGAGGGCAACTGG + Intronic
1047746828 8:127851429-127851451 AGGGTACAGATGAGGGCCATGGG - Intergenic
1048351997 8:133623922-133623944 AGGGTGCAGTGCTGGGAGAGGGG - Intergenic
1048584425 8:135759793-135759815 AAGGTGCAGAGGTAGCACAGAGG - Intergenic
1049351736 8:142168148-142168170 GGGGTGCAGGGGTGGGCCCTGGG - Intergenic
1049431593 8:142567699-142567721 GGGGTGCAAGGGAGGGCCAGAGG + Intergenic
1049545572 8:143229150-143229172 AGGGTGCGTAGGTGTGGCAGGGG - Intergenic
1049658301 8:143808551-143808573 TGGGTGCCCAGGAGGGCCAGGGG + Intronic
1050819201 9:9856274-9856296 ATGGTGCAGGGCTGGGCCATGGG + Intronic
1051419771 9:16877501-16877523 ACGGTGCAGCGGTGGGCCGAAGG + Intergenic
1051743226 9:20271147-20271169 AGGGTGCTGAGGTGGGTGAGTGG - Intergenic
1052359766 9:27541260-27541282 AGGGTGGAGAGGTGTGCTGGGGG + Intergenic
1055513397 9:77016156-77016178 GGGGTGCAGAGCTGGGGCCGCGG - Intergenic
1057185187 9:93053456-93053478 GGGGTGCACAGGTGGGTCAAGGG - Intergenic
1057213831 9:93217577-93217599 GGGGTGCAGATGTGGGCAGGGGG + Intronic
1059359783 9:113733085-113733107 AGGGTGAAGAGGTGGCTCTGTGG + Intergenic
1060419547 9:123457909-123457931 AGAGGGGAGAGGTGGGTCAGTGG + Intronic
1060431203 9:123552607-123552629 AGGGAGCACAGGTGAGCCAGAGG + Intronic
1060982918 9:127803791-127803813 AGGGAGGAGGGGTGTGCCAGGGG - Intronic
1061201477 9:129140797-129140819 AGGGTGGGGAGGTGGGGGAGGGG + Intronic
1061782459 9:133004085-133004107 GGAGTGCAGAGGAGGGCCGGGGG - Intergenic
1061825648 9:133256732-133256754 AGGGTGCAGAGGCGGGTGTGTGG - Intronic
1061922046 9:133787783-133787805 GGACTGCAGAGGTGGGCCTGTGG - Intronic
1062097397 9:134710450-134710472 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097418 9:134710512-134710534 TGGGTGCAGTGGTGGGGCAGGGG + Intronic
1062097454 9:134710604-134710626 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097478 9:134710671-134710693 TGGGTGCAGTGGTGGGGAAGGGG + Intronic
1062097499 9:134710733-134710755 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097513 9:134710766-134710788 GGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097526 9:134710799-134710821 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097539 9:134710833-134710855 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097560 9:134710895-134710917 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097573 9:134710928-134710950 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097586 9:134710961-134710983 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062097606 9:134711023-134711045 TGGGTGCAGTGGTGGGGGAGGGG + Intronic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1062481466 9:136754432-136754454 AGGGTGCCCAGGAGGGGCAGGGG + Exonic
1062566877 9:137167534-137167556 AGGGGGCAGAGGAGGGCGGGCGG - Intronic
1062584360 9:137242223-137242245 AGGGAGCTGAGCTGGGGCAGTGG + Intronic
1062591805 9:137277796-137277818 AGGGCGAGGGGGTGGGCCAGGGG - Exonic
1187390360 X:18882752-18882774 AGGTTGCAGAGTTGGTTCAGTGG - Intergenic
1188397986 X:29708383-29708405 AGGCTGCAGAGGGGGGCAGGAGG - Intronic
1189510727 X:41658621-41658643 AGTGTGAAGAGGTGGGAGAGGGG + Intronic
1190305195 X:49077970-49077992 AGGGGTCAGAAGTGGGCCATGGG - Intronic
1190411634 X:50141895-50141917 ATGGAGCAGAGGTGGGATAGTGG + Intergenic
1192190736 X:68989867-68989889 AGGAAAAAGAGGTGGGCCAGAGG + Intergenic
1192491154 X:71578550-71578572 TGGGTGCTGAAGTGGTCCAGAGG + Intronic
1192671122 X:73143001-73143023 AGGTTGCAGAGGCTAGCCAGTGG + Intergenic
1194981868 X:100449740-100449762 AGGGTGCGGGGGTGGTTCAGGGG - Intergenic
1195272139 X:103242525-103242547 AGGGTGCAGATGTGGACAAATGG - Intergenic
1195363640 X:104107434-104107456 AGGGGCCAGAGGTGGCCCAAAGG - Intronic
1196641540 X:118068517-118068539 ATGGTGCAAAGGTAGGCAAGAGG + Intronic
1196708625 X:118739607-118739629 AAGTTGCAAAGGTGGGACAGAGG + Intronic
1198051210 X:132955390-132955412 AGAGTGAAGAGGAGAGCCAGGGG + Intronic
1198312669 X:135436828-135436850 AGGCTGCGGAGCTGGGCCTGTGG + Intergenic
1198394375 X:136207538-136207560 AGGGTATAGAGGTGGGGGAGTGG + Intronic
1198641111 X:138757251-138757273 AGGGTGGGGAGGTGGGAAAGGGG - Intronic
1199894749 X:152118646-152118668 AGGGTGAGGAGGAGGGTCAGGGG + Intergenic
1200148841 X:153941727-153941749 AGGGAGCAGAGAGGTGCCAGGGG - Intronic
1201291245 Y:12421786-12421808 AGGGGGCCGCGGTGGGCGAGGGG - Intergenic
1202101266 Y:21310224-21310246 GGGGGGCAGCGGTGGGGCAGCGG + Intergenic
1202187144 Y:22197382-22197404 GGGGGGCAGTGGTGGGACAGCGG + Intergenic
1202204216 Y:22389014-22389036 GGGGGGCAGTGGTGGGACAGCGG - Intronic
1202241113 Y:22770837-22770859 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202394099 Y:24404580-24404602 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202476686 Y:25265512-25265534 GGGGGGCAGTGGTGGGACAGCGG + Intergenic