ID: 998371036

View in Genome Browser
Species Human (GRCh38)
Location 5:141661686-141661708
Sequence ATAGAGATGCCCAATGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998371036 Original CRISPR ATAGAGATGCCCAATGAGGG TGG Exonic
901254538 1:7810872-7810894 AAAGAGATGCCCATGTAGGGAGG - Intronic
901443839 1:9294953-9294975 CTAGAGAGGCCCAGAGAGGGCGG + Intronic
901731545 1:11283893-11283915 GTGGAGCTGCCCACTGAGGGAGG - Intronic
904858549 1:33518090-33518112 GTAGGGATTCCCAGTGAGGGCGG - Intronic
905625593 1:39488906-39488928 ATAGAAATGCTAAATGAGGAAGG + Intergenic
908880317 1:68724589-68724611 ATTGAGATATCCAAGGAGGGAGG + Intergenic
909300522 1:74007631-74007653 ATAGAGGGGCCCACTGAGGCAGG - Intergenic
912552969 1:110496383-110496405 AGAGAGATGTCCAGTGAGTGAGG - Intergenic
913212516 1:116593372-116593394 AAAGAGATGGGCACTGAGGGAGG + Intronic
915483596 1:156204439-156204461 ATAGACAGGCCCAAGGAGGCAGG + Intronic
916956884 1:169847022-169847044 ATAGGGAAGCCCAAGGAGAGGGG + Intronic
921241434 1:213188065-213188087 ACAGAGATGCCCAATCTGAGAGG - Intronic
923773139 1:236955248-236955270 AGAGAGATACCCAATCAGTGAGG - Intergenic
1064464244 10:15563274-15563296 ATACAGATGCCCAGTGATGGAGG + Intronic
1065402727 10:25324373-25324395 ATAGAGAGGCCCCAGGAGTGAGG + Intronic
1065496573 10:26335435-26335457 AAAGAGATGCCAAATCAGAGAGG - Intergenic
1065661180 10:28005560-28005582 ATAGTGGGGCCCCATGAGGGTGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1070328484 10:75402541-75402563 GTGGAGATGCCCAAAGAAGGGGG - Intergenic
1070382501 10:75893615-75893637 ACACAGATGCCCAATGAGTCTGG - Intronic
1074979272 10:118606618-118606640 ACTCAGATGCCAAATGAGGGTGG - Intergenic
1076319716 10:129568968-129568990 ATACAGAAGCCCAATGTGTGAGG - Intronic
1078364846 11:10697968-10697990 AGAGAGGTGCCTAATGAGGCAGG + Intergenic
1078584296 11:12567920-12567942 ATAGGGAGGCCCAAGGACGGGGG + Intergenic
1078595212 11:12680559-12680581 ATGGAGCTGCCCAGTGGGGGAGG - Intronic
1082741493 11:56916531-56916553 AAGGAGATACCCAACGAGGGAGG + Intergenic
1083173880 11:60937686-60937708 AAAGAAAGGCCCAAGGAGGGAGG + Intronic
1083265535 11:61545155-61545177 ATAAAGCTGCCCCATGAGAGGGG + Intronic
1086034544 11:82400821-82400843 AGAGAGAGGCCTAAGGAGGGGGG + Intergenic
1089147219 11:116337950-116337972 ACCTAGATGCCCAATAAGGGTGG + Intergenic
1095413737 12:41952717-41952739 ATAGGGATCCCCAAAGAGGAAGG + Intergenic
1095754590 12:45750214-45750236 ATAGGGATGCCCAAGGAGAAGGG + Intronic
1097183395 12:57183732-57183754 ATGGGGATGCCCAATAAGGCAGG - Intronic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1104935225 12:132360857-132360879 ATGGAGATGGCCCAGGAGGGAGG + Intergenic
1105215760 13:18283993-18284015 AAAGAGATGGGCACTGAGGGAGG + Intergenic
1106850986 13:33791303-33791325 ATAAAGATGCTCAATGAGCCTGG + Intergenic
1108677944 13:52753727-52753749 GTGGAGATGCCCAGTGAGAGTGG + Intergenic
1110738978 13:78972227-78972249 AAAGAGAGGCTTAATGAGGGAGG - Intergenic
1114457013 14:22862045-22862067 ATAGAGATGCCCATATGGGGAGG + Intergenic
1117515451 14:56496001-56496023 CCAGAGATGGCCCATGAGGGAGG - Intronic
1119009642 14:70971574-70971596 GTAGAGAAGCCACATGAGGGTGG - Intronic
1119342006 14:73887029-73887051 GGAGGGATGCCCAAGGAGGGCGG - Intronic
1124466132 15:29941481-29941503 GTAGAGATGCCCCATGAGGGTGG - Intronic
1125435690 15:39642868-39642890 AGAGATATGCTCAATGATGGTGG - Intronic
1128599192 15:68981279-68981301 ATATAGATGACCTGTGAGGGTGG - Intronic
1129315487 15:74740673-74740695 AGAGACATGCCCAAGGAAGGAGG + Intergenic
1131710586 15:95050980-95051002 ACATAGATGCCCATTAAGGGTGG - Intergenic
1133128473 16:3662161-3662183 ATAGAGGTTCCCAATGTGAGAGG + Exonic
1133170652 16:3980772-3980794 ATACAGAGGCCCTAGGAGGGGGG + Intronic
1133842690 16:9424582-9424604 ACAGATATGGCCAATGAGGTTGG + Intergenic
1133947615 16:10362281-10362303 ACAGAAAAGCCCACTGAGGGGGG + Intronic
1137932061 16:52598214-52598236 GGAGAGAAGCCCAAAGAGGGGGG + Intergenic
1140890342 16:79279527-79279549 ACAGAGATGCCCACTGCAGGTGG + Intergenic
1143208748 17:5167022-5167044 ATAAAAAGGCCCCATGAGGGAGG + Intronic
1144098606 17:11923993-11924015 ATGGAGATGCCCAGTGAGTGTGG - Intronic
1144618076 17:16795132-16795154 ATAAAAAGGCCCCATGAGGGAGG + Intronic
1144894629 17:18520559-18520581 ATAAAAAGGCCCCATGAGGGAGG - Intergenic
1145137596 17:20423685-20423707 ATAAAAAGGCCCCATGAGGGAGG + Intergenic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1148439733 17:47705764-47705786 AGAGAGACACCCAATGAAGGGGG + Intronic
1149871542 17:60186540-60186562 ATAAAAAGGCCCCATGAGGGAGG - Intronic
1151171226 17:72247872-72247894 AGATAGCTGCCCCATGAGGGAGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1157137541 18:45071419-45071441 AAAAAGATGCCCACTCAGGGTGG - Intergenic
1157594485 18:48855924-48855946 AAAGTGAAGCCCAATGAGTGTGG + Intronic
1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG + Intergenic
1159075962 18:63682473-63682495 AAAGAGATGGGCAGTGAGGGAGG - Intronic
1161282785 19:3454722-3454744 ACAGAGATGCTCAAAAAGGGGGG - Intronic
1162221264 19:9178726-9178748 ATAAAGAGGCCCCAAGAGGGTGG + Intergenic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167131924 19:47592485-47592507 ATAGAGTTGTCAGATGAGGGTGG - Intergenic
1168113802 19:54209602-54209624 AGGGAGATGGGCAATGAGGGTGG + Intronic
925026491 2:611608-611630 TTAGAGATGCTGAATTAGGGTGG + Intergenic
925902771 2:8520325-8520347 ATAGAAAGGCCCAAGGAAGGTGG - Intergenic
926608427 2:14921168-14921190 ATAGGGAGGCCCAAGGAGAGGGG + Intergenic
927319975 2:21732297-21732319 ATAGAAATGAGCCATGAGGGGGG + Intergenic
927583896 2:24281490-24281512 ATAGACATGCACAAAGAGAGAGG - Intronic
927755320 2:25703928-25703950 ATAGGGAGGCCCAAGGAGCGGGG - Intergenic
929436668 2:41933891-41933913 ACAGAGCTTCCCAAGGAGGGTGG - Intergenic
929529759 2:42741593-42741615 ATAGAGATGCTCAAGGAGAGGGG + Intronic
930311014 2:49739493-49739515 AATGAGATGCCCAATGTTGGAGG - Intergenic
930451971 2:51552773-51552795 ATACAGATGACAGATGAGGGAGG - Intergenic
934298571 2:91762732-91762754 AAAGAGATGGGCACTGAGGGAGG - Intergenic
935309874 2:101773059-101773081 ACAGAGAAGCCCAAGGAAGGGGG - Intronic
937100697 2:119265790-119265812 CTAGAGCTGGCCAATGAGGAAGG + Intergenic
941811221 2:169757542-169757564 ATACAGATGCCCAGTGACTGGGG + Intronic
943860067 2:192850169-192850191 ATAGAGAAGCCTAAGAAGGGGGG - Intergenic
946044618 2:216810722-216810744 CAAGAGATGCCCAAGCAGGGAGG - Intergenic
946119578 2:217498086-217498108 AGTGGGATGCCAAATGAGGGTGG + Intronic
1173841016 20:46157338-46157360 ATAGAGCTACCCTATGAGGTTGG + Intergenic
1175323268 20:58104308-58104330 TTAGAGATGCCCTATGATAGAGG - Intergenic
1176625303 21:9087333-9087355 AGAGAGATGCCCAAGAAGAGCGG + Intergenic
1179405520 21:41122306-41122328 AGGGAGATGCCCAAGGAAGGAGG - Intergenic
1182673607 22:32018851-32018873 ATTAAGATGCCCAAGGAGGGTGG - Intergenic
950708488 3:14798500-14798522 AAAGAGCTGCCCAATGAAGGGGG + Intergenic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
954527541 3:51285402-51285424 ATAAAGATGCTCACTGAGGTCGG + Intronic
958438512 3:94127431-94127453 AGGGAGATGCCTAATGAGAGTGG + Exonic
961505791 3:127369866-127369888 TAAGAGATGCCCAGTGAGGGTGG - Intergenic
963082737 3:141409623-141409645 ATAGGGAGGCTCCATGAGGGTGG - Intronic
964372684 3:156017552-156017574 AGAGAGATCACAAATGAGGGAGG + Intergenic
970098871 4:12497516-12497538 AAAGATGAGCCCAATGAGGGAGG - Intergenic
972189345 4:36571152-36571174 ATAGAGAGGCCCAAGGAGAGGGG + Intergenic
975762045 4:77630210-77630232 GTAGAGATGCCCAAAGAGAGGGG + Intergenic
976420815 4:84841749-84841771 ATAGAGATGCCTAATTACGAAGG + Intronic
976815923 4:89148545-89148567 TTGGAGATGCCCAAGGAGTGCGG + Intergenic
977368827 4:96108056-96108078 ATAGAGAGGCCCAAAGAGAGAGG - Intergenic
979816996 4:125120716-125120738 ATAGTGATGGATAATGAGGGAGG - Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
981915911 4:150032993-150033015 AAAGAGATCACAAATGAGGGAGG + Intergenic
983617411 4:169723581-169723603 ATAGAACTGCCAAAAGAGGGTGG + Intronic
986736294 5:10669979-10670001 ATAGTGATGACAAATGATGGTGG + Intergenic
986859568 5:11911137-11911159 ATAGAAATGCCCCTTGAGGCCGG + Intergenic
987748313 5:22006133-22006155 ATAGAGTTACCCAATAAGTGGGG - Intronic
988335416 5:29902043-29902065 ATATAAATGGGCAATGAGGGAGG + Intergenic
991768488 5:70015921-70015943 ATAGAGTTACCCAATAAGTGGGG - Intergenic
991847726 5:70891003-70891025 ATAGAGTTACCCAATAAGTGGGG - Intergenic
997183630 5:131859358-131859380 ATTGAAATCCCCAATGATGGAGG + Intronic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1002679921 5:180953352-180953374 TTATAGATGCACATTGAGGGAGG + Intergenic
1005015490 6:21371463-21371485 ATGGAGATGACCAAGGAGAGAGG - Intergenic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1006807209 6:36796451-36796473 ATGGAGATGCCCTATGAGGGAGG - Intronic
1008790468 6:55225997-55226019 ACAGGGATGCCCAACTAGGGAGG - Intronic
1009963368 6:70551722-70551744 TTAGAGAGGCCCAAGGAGAGAGG + Intronic
1015737756 6:136419057-136419079 AAGGAGATGGCCAATAAGGGTGG + Intronic
1017377373 6:153786966-153786988 ATAGAGATCACCATTCAGGGAGG - Intergenic
1019574801 7:1732198-1732220 ACAGAGAAGCCCACTGAGTGGGG + Intronic
1021100453 7:16583316-16583338 AGACAGATGCCCCATGAGGATGG - Intergenic
1021149274 7:17129344-17129366 AGAGACATGCCCAGTGAGGATGG + Intergenic
1023087812 7:36589579-36589601 ATAACCATGCCCAATGAGCGTGG + Intronic
1023528056 7:41125897-41125919 GGACAGATGCCCAATAAGGGAGG + Intergenic
1023729227 7:43174283-43174305 ATGGAGATCCCTTATGAGGGAGG + Intronic
1024213481 7:47227340-47227362 ATGGAGATGCCCTAGGAGGTGGG - Intergenic
1025813963 7:64892699-64892721 TTATAGATGCCTGATGAGGGGGG + Intronic
1026193346 7:68149738-68149760 AGAGAGATGGAGAATGAGGGTGG + Intergenic
1028533318 7:91863075-91863097 AAGGAGATGGCCAATGAGTGAGG - Intronic
1030488075 7:110196489-110196511 AAAGAAAAGCCCAAGGAGGGTGG + Intergenic
1030740557 7:113104085-113104107 ATACTGAAGCCCAAAGAGGGAGG + Intergenic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1034924539 7:155110629-155110651 ATTGAGATGCCTAAAGGGGGAGG - Intergenic
1035943804 8:3935721-3935743 ATAGCGAGGCCCAATGAAGGAGG - Intronic
1037590925 8:20311371-20311393 ATGGAGATGCTCATTGAGAGGGG - Intergenic
1051275133 9:15391361-15391383 TGAGAGATCCCCAGTGAGGGTGG - Intergenic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1053421378 9:37981789-37981811 ATAGAGAGGCCCAAGGAGAGGGG + Intronic
1059812434 9:117870491-117870513 ATAGCTATGCCCAATGAAGCAGG + Intergenic
1203748479 Un_GL000218v1:57794-57816 AGAGAGATGCCCAAGAAGAGCGG + Intergenic
1186019420 X:5237400-5237422 AAAGAGATGACCACAGAGGGAGG - Intergenic
1186243847 X:7599300-7599322 GAAGAGCTGCCCAATGAGTGTGG - Intergenic
1186829178 X:13373662-13373684 AAAGAAATACCCAGTGAGGGAGG + Intergenic
1189049096 X:37625279-37625301 ACAGAGATGCCCCATGAGTGAGG - Intronic
1191824800 X:65353318-65353340 ATAGGGATGCCCAAAAAGAGGGG - Intergenic
1191976713 X:66880334-66880356 ATAGATATGAGCAGTGAGGGAGG + Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193835658 X:86340489-86340511 ATAGGGACGCCCAAGGAGAGGGG - Intronic
1196017823 X:110958206-110958228 AAAGTGATGCTCAATGAGGTCGG + Intronic
1196099396 X:111831799-111831821 ACAGAGATGGCCATTGTGGGTGG + Intronic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1200406281 Y:2814674-2814696 ATCTAGATGCCCATTGATGGTGG - Intergenic
1200416084 Y:2911524-2911546 AAAGAGATGCCAAATCAGAGTGG + Intronic