ID: 998373376

View in Genome Browser
Species Human (GRCh38)
Location 5:141675226-141675248
Sequence GAATCTACTCAGGTTAGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998373376_998373379 4 Left 998373376 5:141675226-141675248 CCTTAACTAACCTGAGTAGATTC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 998373379 5:141675253-141675275 ATTATTCTCTGTCACTTTCCAGG 0: 1
1: 0
2: 3
3: 27
4: 297
998373376_998373381 6 Left 998373376 5:141675226-141675248 CCTTAACTAACCTGAGTAGATTC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 998373381 5:141675255-141675277 TATTCTCTGTCACTTTCCAGGGG No data
998373376_998373380 5 Left 998373376 5:141675226-141675248 CCTTAACTAACCTGAGTAGATTC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 998373380 5:141675254-141675276 TTATTCTCTGTCACTTTCCAGGG 0: 1
1: 1
2: 0
3: 48
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998373376 Original CRISPR GAATCTACTCAGGTTAGTTA AGG (reversed) Intronic
909700681 1:78518902-78518924 GAATTCACTGAGGTTAGCTACGG - Intronic
909853882 1:80504234-80504256 GCATCTACTCAAGTTTGTTCAGG + Intergenic
915923004 1:159992023-159992045 AAAGCAATTCAGGTTAGTTATGG - Intergenic
916617329 1:166455909-166455931 GACTTTATTCAGGTTATTTAAGG - Intergenic
917008296 1:170440744-170440766 GAATCTATTCAGGTGATATATGG - Intergenic
917935807 1:179865928-179865950 GAAATTATTCAGGTTAGTTAAGG + Intronic
921970768 1:221146739-221146761 GAAACGTCTCAGGTTAGTGATGG + Intergenic
1065699608 10:28411936-28411958 GAATCTGCTGAGGTTGCTTAAGG - Intergenic
1071296460 10:84223902-84223924 GATTCTGCTCAGGCAAGTTAAGG + Intronic
1071805972 10:89121357-89121379 GAATCTAATCAGGCTAGAGAAGG + Intergenic
1073622419 10:105062908-105062930 AAATCTACTCTGGTTATATAAGG + Intronic
1080098583 11:28433298-28433320 GTGTCAACTCAGGTTTGTTATGG - Intergenic
1080467029 11:32507270-32507292 GAATCTACTAAGCTCAGTGAGGG + Intergenic
1092222659 12:6725604-6725626 TAATCTATTCAAGTTAGCTAAGG + Intronic
1093023469 12:14223723-14223745 AAATCTGCTGAGGTTAGTTTTGG + Intergenic
1098943201 12:76560080-76560102 CAATCTCCTCAGGTTAGGAAGGG - Intergenic
1104528720 12:129548910-129548932 CAGTCTACTCAGGTGAGCTAAGG - Intronic
1105680429 13:22720938-22720960 CATTCTACTCAAGTTAGTAATGG - Intergenic
1111803611 13:93010408-93010430 GAATCTAGTCAGGATATTTGTGG - Intergenic
1116514680 14:45790526-45790548 GAATCTATCCAGCATAGTTAGGG - Intergenic
1117092238 14:52262748-52262770 GTTTCCAGTCAGGTTAGTTAAGG + Intergenic
1117564082 14:56976075-56976097 GAATCTACCCAGGAAATTTAGGG - Intergenic
1117578294 14:57124192-57124214 GAATCTACTCTGGTTCATTGAGG + Intergenic
1120299251 14:82684924-82684946 GATTTTACTCAGGTGATTTAGGG - Intergenic
1122345106 14:101053789-101053811 GAATCTACCCAGGGCAGTGATGG + Intergenic
1126088455 15:45030739-45030761 GAATCCACACAGGATAGTTAAGG - Intronic
1126911068 15:53417591-53417613 GAATCTTCTCAGTTTGGTTTAGG + Intergenic
1138901338 16:61274584-61274606 GAATCTTCTCAAGTTGGTTTTGG + Intergenic
1140345648 16:74210689-74210711 GAATCTTCTGAGGTTAGATTAGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153178297 18:2404197-2404219 GAATATAATCATGTTATTTAGGG + Intergenic
1154283727 18:13032119-13032141 GAATCTTCTCCTGGTAGTTAGGG + Intronic
1161133643 19:2606805-2606827 GAACCTTCTCAGTTTAGTTTTGG - Intronic
933031094 2:77329630-77329652 GAAGGTGCTCAGGTTAGTAAGGG + Intronic
933733265 2:85474328-85474350 GAATTTTCTCAGGTGACTTAAGG + Intergenic
936271380 2:111051985-111052007 GCATCTTCTCAGGTTAGGCAAGG - Intronic
937263983 2:120604611-120604633 GCATCTACTCAGGTTTGGTGAGG - Intergenic
939872649 2:147542060-147542082 GTATTTACTCAGTTTACTTAGGG - Intergenic
939989228 2:148861737-148861759 AAATCTACTTAGGCTAGCTAAGG - Intergenic
942551667 2:177126258-177126280 GAATCCACTCAGGCTAGTTTTGG - Intergenic
945540489 2:211080619-211080641 GATTCAAGTCAGGTTAGTTCTGG - Intergenic
948035381 2:234854257-234854279 GAATAACCTCATGTTAGTTAAGG - Intergenic
948453718 2:238094281-238094303 GCATCTACCCAGAATAGTTACGG - Intronic
1170171692 20:13420878-13420900 AAATCTACTCAGTATAGATAAGG + Intronic
1175303358 20:57958762-57958784 GAATCCACTCTGGTTAGTGCTGG + Intergenic
1182642913 22:31782699-31782721 GAATCTACCTAGGAAAGTTATGG - Intronic
953440024 3:42908898-42908920 GCATCTCCTCAGGTGAGTGAGGG + Exonic
956152351 3:66257177-66257199 GAATCTTTTGAGGTTAGATAAGG + Intronic
958952484 3:100431417-100431439 GAATCTAAACAGGTTAATTCAGG - Intronic
963934353 3:151036785-151036807 GAATCTACTCAGTTTAAGGAGGG + Intergenic
965124031 3:164601129-164601151 GAAACTACTCAGTTTGGTTTTGG + Intergenic
967413081 3:189186665-189186687 GAATCTACTCAGGTCTGGTGTGG - Intronic
968783493 4:2600921-2600943 AAATCTTGTCAGGTTAGTTTTGG + Intronic
972692425 4:41412428-41412450 GTATCTACAGAGGTTACTTAAGG + Intronic
973671617 4:53224611-53224633 GCATCTACTAAGGTTATTTGGGG - Intronic
974515572 4:62904018-62904040 TACTCTACTCAGGTTGGTTTTGG + Intergenic
974817286 4:67021708-67021730 CAATTTCCTCATGTTAGTTAGGG + Intergenic
981792840 4:148559317-148559339 GAATCAACTCAGTTGATTTATGG - Intergenic
985023265 4:185713549-185713571 GGCTCTACACAGGGTAGTTAGGG + Intronic
986226325 5:5817855-5817877 GAATCTATTGAGGTTTGTAAGGG - Intergenic
987648723 5:20711746-20711768 GAATTTACTCAGATTACTCACGG - Intergenic
988747607 5:34157182-34157204 GAATTTACTCAGATTACTCACGG + Intergenic
989301678 5:39902572-39902594 GAATGTACTCAGGAGAGTAAGGG - Intergenic
995930304 5:117433864-117433886 GAATATACTCAGATTAATTTAGG - Intergenic
998373376 5:141675226-141675248 GAATCTACTCAGGTTAGTTAAGG - Intronic
999972159 5:156875664-156875686 GACTCAACTCTGGATAGTTAGGG - Intergenic
1001761681 5:174212980-174213002 AAATCTTCTGAGCTTAGTTAGGG + Intronic
1005545108 6:26859534-26859556 GAATTTACTCAGATTACTCACGG + Intergenic
1009015898 6:57901156-57901178 GAATTTACTCAGATTACTCACGG + Intergenic
1011360964 6:86524551-86524573 GTATATACTTAGGATAGTTAAGG + Intergenic
1013979427 6:116112196-116112218 GTACCTACTTGGGTTAGTTAGGG + Intronic
1022202542 7:28131147-28131169 GAAACTACTAAGGGAAGTTAGGG - Intronic
1022727597 7:32995250-32995272 AAACCAACTCAGGTTAGGTATGG - Intronic
1025045986 7:55692391-55692413 AAACCAACTCAGGTTAGGTATGG + Intergenic
1031986268 7:128166598-128166620 GCATCTACTCAGGTGTGTGAGGG + Intergenic
1044176604 8:89132326-89132348 GATTCTACTCAGATAAGTTTGGG + Intergenic
1048447227 8:134500396-134500418 GAGCATACTCAGGTTAGCTAAGG + Intronic
1049328807 8:142038861-142038883 GAATCCACTCAGGTAAGTGGAGG + Intergenic
1052401690 9:28008460-28008482 GATTCTACTCAAGACAGTTATGG + Intronic
1055590591 9:77809177-77809199 CAATCTACTCATGTTCTTTACGG + Intronic
1058691071 9:107521347-107521369 GAATCCAGGCAGGTTAGTTATGG + Intergenic
1193661260 X:84261556-84261578 GAATCTTCTAAAGTTAGTAAGGG - Intergenic
1200926502 Y:8659550-8659572 GAATGTAGTCTGGTTAGTTGAGG - Intergenic