ID: 998374516

View in Genome Browser
Species Human (GRCh38)
Location 5:141682065-141682087
Sequence GGGGAGGGCCGCCGGCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998374504_998374516 15 Left 998374504 5:141682027-141682049 CCGGGCAGCAGGAGGGAGGGGCG 0: 1
1: 0
2: 5
3: 80
4: 660
Right 998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG 0: 1
1: 0
2: 4
3: 38
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998374516 Original CRISPR GGGGAGGGCCGCCGGCGCCG AGG Intronic
900095963 1:940244-940266 GGGGAGGGGCGCCGGCCGCCGGG + Intronic
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900382570 1:2392064-2392086 GGGGAGGGCCGTCGGGGCCCGGG + Intronic
900671300 1:3856809-3856831 GGCGCGGGGCGCGGGCGCCGCGG - Intronic
901628848 1:10638626-10638648 GGGGAGGGGCGCCGGGGCAGCGG + Exonic
901796165 1:11680878-11680900 GGGCAGGGCCGCGGACGCAGAGG + Intronic
902558310 1:17260193-17260215 GGGGAGGGACACCGGTGCCTGGG + Intronic
903628035 1:24745326-24745348 TGGGAGGGGCGCCGGGGGCGGGG - Intergenic
904030031 1:27528007-27528029 GGCCAGGGCCGCCAGCCCCGGGG + Intergenic
904768964 1:32870618-32870640 GGGGCGGGGGGCCGGCGCCGGGG - Intronic
905775747 1:40666001-40666023 GGGCAGGGCAGGGGGCGCCGTGG - Intergenic
906532775 1:46533051-46533073 GCAGACGGCCGCGGGCGCCGGGG + Intergenic
908195356 1:61742362-61742384 GGGGAGGGAGCCCGGGGCCGCGG - Intergenic
908272943 1:62437620-62437642 GGCGAGGGCGCCCGGCGCGGGGG + Intronic
908355781 1:63323841-63323863 GGCGGCGGCGGCCGGCGCCGCGG + Exonic
909433453 1:75615682-75615704 GGGGAGGTGCAGCGGCGCCGCGG + Intergenic
910981249 1:92961556-92961578 GGGGAGCGCGGCGCGCGCCGCGG - Intergenic
912270037 1:108199902-108199924 AGGGAGGGCTGCGGGCGCTGGGG - Intronic
912625742 1:111203839-111203861 GGGCAGGGGCGCTGGCTCCGAGG + Intronic
913186299 1:116373352-116373374 TGGGAGGGCGGCCGGCGGCTCGG - Intronic
914702874 1:150150131-150150153 AGGGAGGAGCGGCGGCGCCGGGG + Exonic
915580136 1:156808578-156808600 TGGGAGGGCCGCAGAGGCCGAGG + Intronic
916694289 1:167221000-167221022 GGGGGGGGCAGCGGGAGCCGGGG - Intronic
917659610 1:177164595-177164617 GGCCACGGCCGCCGGCGACGTGG - Exonic
917846578 1:179025693-179025715 GGAGACCGGCGCCGGCGCCGAGG + Intergenic
917904583 1:179576002-179576024 GGGGCGGGACACCGGGGCCGCGG + Intergenic
918064220 1:181088869-181088891 GCACAGGGCCGTCGGCGCCGGGG - Exonic
919458320 1:197846294-197846316 TGGGAGGACCGCCTGAGCCGGGG - Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920362794 1:205430770-205430792 AGGGAGGGCGGCTGGAGCCGCGG - Intronic
922440734 1:225653268-225653290 GGGCCCGGCCGCCGGCGCGGGGG - Intergenic
922704110 1:227779938-227779960 GTGGAGGGCAGCCAGCACCGTGG - Intronic
922739369 1:228006878-228006900 GGGGGCGCCCGCCGGGGCCGGGG - Intergenic
923007864 1:230066894-230066916 GGGGCGGGCGGCCGGGGGCGGGG + Intronic
923333961 1:232950822-232950844 GGGGAGGGTCTCCGGCTCCAGGG + Intronic
924384318 1:243487968-243487990 GGGCAGGGCCGGGGGAGCCGTGG + Intronic
924801441 1:247331758-247331780 GGGGCCGGCCGCGGGAGCCGGGG + Intronic
1062854665 10:773912-773934 GGGGAGGGCGGCAGGCCCTGCGG + Intergenic
1064230986 10:13529053-13529075 GAGGAGGGGCGCCGGCGGAGGGG + Intergenic
1065102592 10:22345584-22345606 GAGGAGGGCAGACGGCGGCGGGG + Exonic
1066432240 10:35363019-35363041 GTGGTGGGCCGCCGGCGGCCGGG + Intronic
1069991627 10:72319881-72319903 GGGGAGGGCGCCCGGTGCGGGGG + Intergenic
1070610165 10:77927090-77927112 GGGACGGGCCGGCGGCGGCGGGG - Intergenic
1072188509 10:93063033-93063055 TGGGAGGCCCGCCCGCGCCGCGG - Intronic
1073099595 10:100999775-100999797 GGCCAGGGCCGGGGGCGCCGCGG + Exonic
1073135075 10:101215869-101215891 GGCAAAAGCCGCCGGCGCCGGGG + Intergenic
1075144456 10:119872142-119872164 GGGGAGGGCCCGCAGAGCCGCGG - Intronic
1076371606 10:129959301-129959323 GGCGAGGGAGGCCGGGGCCGGGG + Intronic
1076674841 10:132142485-132142507 GGGGAGAGGGGCCGGGGCCGGGG - Intronic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076853182 10:133103034-133103056 GGGGAGGGGCGCCGGAGGGGAGG + Intronic
1076888415 10:133272913-133272935 TGGGAGAGCAGCCGGCGGCGGGG - Intronic
1076900417 10:133335133-133335155 GGCGAGGGCAGCCAGCGCCGGGG + Intronic
1076991921 11:279941-279963 TGGGAGGGCCGCCAGGGGCGTGG + Intronic
1077287685 11:1775058-1775080 GGGGAGGGCCTCCGGCAGGGGGG + Intergenic
1077395050 11:2316519-2316541 GGGGAGGGGCGCCCGCACCCTGG + Intronic
1077487969 11:2847844-2847866 TGGGGGGGCCGCCGCTGCCGGGG - Exonic
1077488558 11:2850180-2850202 GGGGTGGGCGGCCGGGGCTGGGG - Intergenic
1079056001 11:17207505-17207527 GGGGAGGGGGGCCGGCGGCCGGG + Intronic
1080802117 11:35618713-35618735 GGGGAGGGCTCCTGCCGCCGCGG + Exonic
1081528396 11:43942463-43942485 GCGGGGGGCGGGCGGCGCCGGGG + Exonic
1081773863 11:45665095-45665117 CGGGAGGGGCGCGGGCGCGGTGG - Intronic
1081805011 11:45885721-45885743 CGAGAGGGCAGCCGCCGCCGCGG - Exonic
1081872421 11:46389531-46389553 GGAGCGAGCCGCCGCCGCCGGGG + Intergenic
1083753868 11:64778569-64778591 GGGGCGGGCCGGGGGCGGCGGGG + Intronic
1083921077 11:65781528-65781550 GGGGCGAGGAGCCGGCGCCGCGG + Intergenic
1083945119 11:65919205-65919227 GGGGCGGGCCGCGGGGGGCGGGG + Intergenic
1084153124 11:67300406-67300428 GGGAAGGGCCCCCAGCGACGTGG + Intronic
1084165268 11:67372561-67372583 GGGCGGGGCCGGGGGCGCCGAGG - Intronic
1084175619 11:67420844-67420866 AGTGAGGGCGGCCGGGGCCGGGG + Intronic
1084605622 11:70170054-70170076 GGGGAGGGCCGCAGGGGCAGAGG + Intronic
1088613857 11:111603184-111603206 GGGGAGGGGCGCCGGGGTCACGG - Intronic
1089729588 11:120511905-120511927 GGAGCGGGCCGGGGGCGCCGCGG - Intronic
1090636879 11:128694904-128694926 CTGGAGAGCCGCCGGCTCCGCGG + Intronic
1091807350 12:3365996-3366018 GGGGTGGGGCGCCGGGGGCGGGG - Intergenic
1096156973 12:49346367-49346389 GGGGAGGGGCGACGGGGTCGGGG - Intergenic
1096700619 12:53380486-53380508 GGGATGGGCCGCCCGCCCCGGGG + Intronic
1099014276 12:77325613-77325635 GGGGAGGGCTGTCAGCGCCAGGG + Intergenic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1103309015 12:119989678-119989700 GGCGCGTGCCGCCGGCGCGGGGG + Intergenic
1103507596 12:121452496-121452518 AGGGAGGACCGCCGGCCCCCGGG + Intronic
1103563744 12:121805230-121805252 GGGGAGGGACGGCGGGGCAGTGG - Intronic
1103915217 12:124372491-124372513 GGGGTGGCCCGTCGGCGCCCAGG + Exonic
1103937964 12:124486471-124486493 AGGGAGGGCCTCCGCCGCTGGGG + Exonic
1104008881 12:124915023-124915045 GGGGAGGGGCCGCGGAGCCGCGG - Exonic
1104929251 12:132329475-132329497 GAGGGGGGCCGGGGGCGCCGGGG + Intergenic
1104982832 12:132581852-132581874 GGGGAGGGGCGCGGGCATCGGGG - Intronic
1104989718 12:132618798-132618820 GGTGGGGGCCGCCCGCGCCATGG + Exonic
1105004167 12:132710821-132710843 GCGGAGCGCCGTCGGGGCCGTGG + Exonic
1105820807 13:24079142-24079164 GGGGAGGGCAGCGGGTGCCTAGG + Intronic
1106956333 13:34942682-34942704 GGGGAGCGGGCCCGGCGCCGCGG + Exonic
1108541686 13:51452332-51452354 GGGGAGGGCGGCCGGGGCGGGGG - Intronic
1110119607 13:71865789-71865811 GGAGAGGGCCGCGCTCGCCGGGG + Intronic
1110119633 13:71865880-71865902 GGGAAGGGGCGCGGGCGGCGGGG + Intronic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1111518212 13:89363179-89363201 GGAGGTGGCCGCCGGAGCCGGGG - Intergenic
1112216348 13:97434377-97434399 GGGGCGGGCCGCCGGGGCCGGGG + Exonic
1112291036 13:98143798-98143820 GGGGAAGGGCGCCGGGGTCGGGG - Intronic
1112402144 13:99086556-99086578 GCGGGGGGCCGCGGACGCCGAGG - Intronic
1112504515 13:99968279-99968301 CGGGAGGGACGCAGGCGCCTCGG - Intronic
1113036189 13:106052452-106052474 AGGGAGGGCCGCGGGCCCCTGGG - Intergenic
1113185985 13:107686069-107686091 GGGGAGGACGGCGGGGGCCGGGG + Intronic
1113799993 13:113081294-113081316 GGGGAGGGCCGACTGCCACGGGG + Intronic
1113914832 13:113863960-113863982 GAGGCGAGCCGCGGGCGCCGCGG + Exonic
1113962526 13:114133349-114133371 GGGGAGACCTGCCGGTGCCGGGG - Intergenic
1115028481 14:28767714-28767736 GGAGAAGGGCGCCGGCGCCGGGG + Exonic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1116821845 14:49634428-49634450 GGGGAGGGCGCCCGGGGCCCGGG + Exonic
1116945278 14:50830712-50830734 GGGGCGGGCCGGCGGGGGCGGGG - Intronic
1117131982 14:52695772-52695794 GGGGACGGGCGCGGGCGCAGCGG - Intronic
1117424460 14:55580376-55580398 CGGGACGGGCGCCGGCGGCGGGG + Intronic
1118292924 14:64541976-64541998 GAGGATGGCCGCCTGCACCGCGG - Exonic
1119500870 14:75126672-75126694 AGACAGGGCGGCCGGCGCCGAGG + Intronic
1121101842 14:91254761-91254783 GGGGAGGGCCACAGGAGCCAAGG - Intergenic
1122070145 14:99200818-99200840 GGGGAGGGCTCCAGGCCCCGAGG - Intronic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1122635407 14:103127381-103127403 GCGGCCGGCCGCGGGCGCCGAGG + Exonic
1122666680 14:103334713-103334735 GGAGGGGGCGGCCGGCGCCCGGG - Intronic
1123630778 15:22258289-22258311 GGGGAGGCCGGGGGGCGCCGGGG - Intergenic
1124125502 15:26935486-26935508 GGGGAGGCCGGCTGGGGCCGAGG - Intronic
1124469381 15:29969134-29969156 GGGCAGGGCGGCCGGCGCGCAGG - Intergenic
1125534712 15:40436471-40436493 GGGGAGGGTCGACGCTGCCGGGG - Intergenic
1125722218 15:41850809-41850831 GGGGAGGGCGGCCGACTCCCTGG - Intronic
1126823671 15:52528931-52528953 GGGGAGGGCCGCGCGGGGCGGGG + Exonic
1128067878 15:64775642-64775664 GGGGGCGGGCGCCGGCGGCGGGG + Intergenic
1128992567 15:72272805-72272827 GGGGGGTGGCGCCTGCGCCGTGG + Intronic
1129710915 15:77819865-77819887 GGAGAAGGGCGGCGGCGCCGCGG - Intronic
1129810678 15:78507554-78507576 GAGGAGGGGCGCGGGCGCTGCGG + Intronic
1130994193 15:88895061-88895083 GGGCAGGGCCTGGGGCGCCGCGG + Intronic
1131160566 15:90102310-90102332 TGTCAGGGCCGCCGGCGCCCAGG + Exonic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1131831458 15:96357236-96357258 GGGGAAGGCTGGCGGCGGCGGGG + Intergenic
1132163846 15:99566104-99566126 GGTGAGGGCCGCGGGCAGCGGGG + Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132889384 16:2196502-2196524 GGGGGAGGCGGCCGGTGCCGCGG - Exonic
1133802305 16:9093033-9093055 GGGAAGGGCCGCCTGCGTCAGGG + Intronic
1134419389 16:14071542-14071564 GGGCGGGGCGGCCGGGGCCGCGG + Intronic
1136399804 16:30011087-30011109 GGGGAGGGGCGCTGGGGCTGGGG + Intronic
1136566407 16:31073309-31073331 GGAGGGGGCCGCCGGCGCCTGGG + Intronic
1136641526 16:31569345-31569367 GACGAGGGCGGCGGGCGCCGGGG + Intergenic
1136775971 16:32872140-32872162 GGAGAGGGCAGCCGGCCCCTGGG - Intergenic
1136894644 16:33989372-33989394 GGAGAGGGCAGCCGGCCCCTGGG + Intergenic
1137300253 16:47142986-47143008 GGGGCGGCGCGCGGGCGCCGCGG - Intronic
1137617475 16:49856178-49856200 GGAGGGGGCCGCAGGGGCCGGGG - Intronic
1137683274 16:50368984-50369006 GGGGCGCGCGGCCGGCGCAGAGG + Intergenic
1138113946 16:54345422-54345444 GGGGAGGGCCCACCCCGCCGAGG - Intergenic
1139528097 16:67528779-67528801 GGGGAGGGGCGGCGGGGCGGCGG + Intronic
1139826652 16:69762466-69762488 GGGGTGGGCCGGGGGCGGCGCGG + Intronic
1141132445 16:81445151-81445173 GGTGCGGGCCGCCGGATCCGGGG + Exonic
1141635289 16:85311120-85311142 GGGGAGGGCAGCCTGCTCCGTGG + Intergenic
1141682617 16:85553365-85553387 ACAAAGGGCCGCCGGCGCCGAGG + Intergenic
1141841994 16:86579322-86579344 GTGGAGGGGCGCCGGCGGAGAGG - Exonic
1142028850 16:87828567-87828589 TGGGAGGGCCGCCGAGGCTGAGG + Intergenic
1142136418 16:88453770-88453792 GGTGAAGGTCGCCGGCGCCCAGG - Intronic
1142393082 16:89815733-89815755 GGGGAGGGTCGCCTGAGCCCGGG - Intronic
1203078387 16_KI270728v1_random:1134249-1134271 GGAGAGGGCAGCCGGCCCCTGGG - Intergenic
1142474395 17:180817-180839 GGGGCGCGGCGCCGGCTCCGAGG + Intronic
1142518965 17:491828-491850 GGGGAGGGCTGCAGGTGGCGTGG - Intergenic
1142668944 17:1478559-1478581 AGGGAGGGCCGTCGGCGAGGCGG - Intronic
1142683289 17:1562475-1562497 GGGGACGGCCGCCGGGGCGACGG - Intronic
1142810694 17:2394234-2394256 GCCGAGGGCCGCCGGGGCCCGGG + Intronic
1142848377 17:2692751-2692773 CGCGAGTGCCGCCCGCGCCGGGG - Intronic
1143021572 17:3919464-3919486 GGGGAGGGCCGACAGCTACGGGG + Intergenic
1143027133 17:3947562-3947584 GGGGATGGCCGCCACCGCCAGGG + Exonic
1143135529 17:4710510-4710532 GGAGAGGGCGGGCAGCGCCGCGG + Intronic
1143676388 17:8436082-8436104 GCGCTGGGCCGGCGGCGCCGAGG + Intronic
1144500892 17:15786323-15786345 GGGGAGGGACGGGGGCGCCCAGG + Intergenic
1144953033 17:19004220-19004242 GGGGAGGGGCGGCGGGGGCGGGG + Intronic
1144999738 17:19295806-19295828 TGGGAGGGCCCCAGGTGCCGCGG + Intronic
1145163054 17:20588985-20589007 GGGGAGGGACGGGGGCGCCCAGG + Intergenic
1145214764 17:21043086-21043108 GGGGCGGGGCGCCGCGGCCGCGG + Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148225253 17:45894734-45894756 GGCGAGGGGCGGCGGCGCAGGGG - Intronic
1148462670 17:47847358-47847380 GGGCAAGGCCGGCGGCGCAGTGG - Exonic
1148698760 17:49576093-49576115 GGGGAGGGCCGCGGGCCGCCGGG + Exonic
1148742760 17:49902069-49902091 GGCGAGGGGCTCCGGCGCGGCGG + Intergenic
1148754492 17:49965597-49965619 GGGGAGGGGATACGGCGCCGCGG - Intergenic
1148795597 17:50195249-50195271 CAGGAGGGCCGCCGGGGCCCTGG + Exonic
1148830161 17:50426057-50426079 GGGGAGGGCCGCGGGGTCGGAGG + Intergenic
1150108260 17:62478129-62478151 GGGGCGGGCCGGCGGCTCCGGGG + Intronic
1150150913 17:62808267-62808289 GGCAAGGCCGGCCGGCGCCGCGG - Exonic
1150168333 17:62966149-62966171 GGGGAGGGGCGCGAGCGCGGAGG - Intergenic
1151608332 17:75154275-75154297 TGGGAGGGCCGCTGCCGGCGGGG - Intronic
1151662406 17:75525763-75525785 GGGGCCGGCGGCGGGCGCCGAGG + Exonic
1151858267 17:76737944-76737966 GGGCCGAGCGGCCGGCGCCGCGG + Exonic
1152111338 17:78359281-78359303 GGAGAGGGCCCCCGGGGCAGTGG - Intronic
1152111617 17:78360212-78360234 GGGAGGGGCCGCGGGCGCCGAGG + Intergenic
1152125548 17:78444572-78444594 GGGCGGGGCCCCCGGCGCGGCGG + Intronic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152175039 17:78781988-78782010 GATGAGGGTCGCCGGGGCCGGGG - Intronic
1152353914 17:79797731-79797753 GGGGAGGGGGGCGGGGGCCGGGG - Intronic
1152376614 17:79921916-79921938 GGGGAGGGCCGGCGGGACAGTGG - Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152847875 17:82613695-82613717 GGGGAGGGCCGGTGCCGCCAGGG + Intronic
1153515223 18:5895606-5895628 GGGGAAGGCCGGCGGCGTGGGGG - Intronic
1153773392 18:8433086-8433108 GGTGAGGGCCCTCGGCGGCGGGG + Intergenic
1153855138 18:9137338-9137360 GGTGAGGGGCGCCCGCGACGAGG - Intronic
1153900485 18:9614155-9614177 GGGGAGGGCGGGCGGCGGCGAGG - Intronic
1154214877 18:12408323-12408345 GGCGGGGGCGGCCGGAGCCGGGG + Intronic
1154303869 18:13217408-13217430 GGGGAGGCGCGCGGGCGCCGAGG - Intergenic
1155951218 18:31915472-31915494 GGGGGGGGGCGCAGGCGCAGTGG + Intronic
1158427449 18:57352666-57352688 GGGGGAGGCCACCGGGGCCGGGG - Exonic
1160023960 18:75204183-75204205 GGGGAGGACTGCCGTCGCAGAGG - Intronic
1160163326 18:76491549-76491571 GGGGCGGGGGGCGGGCGCCGGGG + Intronic
1160592222 18:79951218-79951240 GGGGAGGGGTCCCAGCGCCGGGG + Intronic
1160613947 18:80109689-80109711 GGGGCGGGCCGCGGGCGCGTCGG - Intronic
1160725599 19:616638-616660 GGGGACGGCCGGGGGCGCGGAGG - Exonic
1160864570 19:1251094-1251116 GGCGGCGGCCGCCTGCGCCGGGG + Intronic
1160967599 19:1753478-1753500 GGGAGCGGCCGCCGGCGCCCGGG - Exonic
1161006765 19:1941103-1941125 GGCGCGCGCCCCCGGCGCCGTGG + Intergenic
1161065647 19:2236099-2236121 GGGGCGGGAGGCCGGGGCCGGGG - Intronic
1161203678 19:3029323-3029345 GGGGCGGGCCGCGGGCGCGTGGG - Intronic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161400734 19:4065550-4065572 GGGATTGGCCGCCGGCGGCGGGG - Intronic
1161849415 19:6730948-6730970 GGGCAGGGCCGGCGGCTCTGGGG - Intronic
1162341894 19:10096296-10096318 GGCGGCGGCCGACGGCGCCGTGG - Exonic
1162445131 19:10718224-10718246 GCCGGGGGCCGCCGGCGCCATGG + Exonic
1162535742 19:11262213-11262235 GGGGAGGGCCGCGGGGGTCCCGG - Intronic
1162675329 19:12294447-12294469 AGAGAGGGGCGCCGGGGCCGGGG + Intronic
1162778751 19:12995909-12995931 CGGGAGGCCGGCCGGCGGCGCGG + Intronic
1162900934 19:13795351-13795373 GGGGAGGGCCGAGGAGGCCGAGG + Intergenic
1163138652 19:15331972-15331994 GGTGGGGGGCGCGGGCGCCGCGG - Intronic
1163832636 19:19554380-19554402 AGGGAGGGCCGGGGGCTCCGAGG + Intergenic
1164639004 19:29811637-29811659 GGGGCGGGCCGCGGGCGCCGGGG - Intergenic
1165157228 19:33796057-33796079 GAGGAGAGCAGCCGCCGCCGCGG - Intronic
1165998015 19:39858868-39858890 GGGGAAGCCCGCCGGGGTCGGGG + Intergenic
1166064352 19:40348398-40348420 GGGGCGGGCAGCCCGGGCCGGGG - Intronic
1166231419 19:41427442-41427464 AGGGAGGGCCCCAGGGGCCGGGG + Exonic
1166294666 19:41883143-41883165 GGGGAGGGGCGGCGGGGCGGGGG + Intronic
1166547044 19:43639890-43639912 GGGGCGGGGCGCCGAGGCCGGGG + Intergenic
1167520751 19:49953187-49953209 GGGTAGGGGCGCCGGCTCAGGGG - Intronic
1168339113 19:55613773-55613795 GGGCAGGGCCGCCACCGCCTTGG - Exonic
1168401680 19:56088978-56089000 GGGGCGGGCGGCCGCGGCCGGGG + Exonic
925609636 2:5692514-5692536 GACGACGGCCGCCGGCGCGGTGG - Intergenic
925928339 2:8685882-8685904 GGGCAGCGCGGCTGGCGCCGCGG - Intergenic
926018293 2:9473784-9473806 GGCCAGGGGCGCCGGCGCAGAGG - Intronic
926198167 2:10775966-10775988 GGGGAGGAGCGCCGTGGCCGCGG + Intronic
927159217 2:20242380-20242402 GGGAAGGGCCCCCGGACCCGCGG + Intergenic
927187344 2:20491290-20491312 GGGGAGGGCCGGCGGAGAAGTGG - Intergenic
927520493 2:23695418-23695440 GGGGAGGGCCGGGAGCGCAGGGG - Intronic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
927713863 2:25341040-25341062 CGGGAGGGGCGGCGGGGCCGGGG - Intronic
927881498 2:26692828-26692850 GGCGCGGGCCGGGGGCGCCGGGG + Exonic
928313919 2:30231847-30231869 TGCGAGGGCAGCCGGCGGCGCGG + Intronic
929789795 2:45014074-45014096 GCGGAGGGGCGCGGGCGCGGCGG + Intergenic
931254351 2:60556838-60556860 GGGGAGGGCACCAGGGGCCGGGG - Intergenic
931321462 2:61177656-61177678 GGGCCGGGCCGCGGGAGCCGGGG + Exonic
931671741 2:64653949-64653971 GGGCGGGGCCTGCGGCGCCGGGG - Intronic
932036561 2:68252259-68252281 GGGGAGGGGAGGCGGCGCCGCGG + Exonic
932616187 2:73233142-73233164 GGAGATGGTCCCCGGCGCCGCGG - Exonic
932709610 2:74052582-74052604 GGGGAGGGGCCCGGGCGCTGTGG + Intronic
932812021 2:74833934-74833956 GGGGAGGCGCGCCGGGGGCGGGG - Intergenic
934712960 2:96527632-96527654 GGGGAGGGCGCCCAGCGGCGCGG - Intergenic
934856194 2:97731896-97731918 AGGGAGGGCAGCTGGCCCCGTGG - Intronic
935301570 2:101697765-101697787 GGCGCGGGGCGCGGGCGCCGGGG + Intronic
936104540 2:109613776-109613798 GGTGAGTCCCGCCGACGCCGGGG - Exonic
936537730 2:113324956-113324978 AGGGAGGGTTGGCGGCGCCGAGG - Intergenic
937273510 2:120670123-120670145 GGGAAGGGCCGCAGCCGCTGAGG - Intergenic
938338899 2:130522735-130522757 GGGGAGGGCCACGGGCCGCGGGG + Intronic
938350939 2:130598015-130598037 GGGGAGGGCCACGGGCCGCGGGG - Intronic
940883312 2:158968500-158968522 GGGGAGGGGCGCGGGAGGCGCGG + Intergenic
941367019 2:164621546-164621568 GGTGGGGGCCGCGGGCGGCGAGG + Exonic
941905729 2:170715463-170715485 GGAGCGGGACGCCGCCGCCGAGG - Exonic
942458339 2:176152500-176152522 GGGGAGGGCCGCGGGCCTCGGGG + Intronic
943639702 2:190344226-190344248 GGGCAGGGCCAAGGGCGCCGCGG - Intronic
944412027 2:199455884-199455906 CGGGAGGCCCAACGGCGCCGTGG - Exonic
944831252 2:203535497-203535519 GGGAAGGGCGGCGGGCGCGGCGG - Intergenic
945431607 2:209771856-209771878 GGGGAGGGCTGGAGGAGCCGCGG - Intergenic
947534770 2:230933708-230933730 GGGGAATGCTGCCGGCGCAGGGG - Intronic
948190536 2:236054875-236054897 GGGGAGGGCAGCCGGGGAGGGGG - Intronic
948436346 2:237956473-237956495 GGGGAGGTCGGTGGGCGCCGTGG + Intergenic
948953898 2:241272631-241272653 GGGGAGGGGCCCGGGTGCCGCGG - Intronic
949018229 2:241725484-241725506 GAGGAGGGCAGCCGCCGCCACGG - Exonic
1168795953 20:610311-610333 GGCGGGGGCCGGCGGGGCCGTGG - Exonic
1168796025 20:610495-610517 GGGGTGGGCCGCCGGCTCCCGGG - Intergenic
1169213110 20:3778520-3778542 GGGACCGGCCGCCGGCGCCTCGG - Exonic
1171994920 20:31723612-31723634 GGGGCGGACCGCCGGGGGCGAGG - Intronic
1172026409 20:31951828-31951850 GGGCCTGGCGGCCGGCGCCGTGG - Intronic
1172277171 20:33686091-33686113 GGGGCCGGCGGCGGGCGCCGCGG + Exonic
1172661739 20:36573465-36573487 GGGGCGGGCCGTCGGCGCCGAGG - Intergenic
1173120795 20:40287264-40287286 GAGGGAGGCCGCCGGCGCCCGGG - Intergenic
1173800321 20:45891004-45891026 GGGCAGGCCAGCTGGCGCCGGGG + Exonic
1174188169 20:48721751-48721773 AGGGAGGCCCGCTGGGGCCGTGG + Intronic
1174579585 20:51562382-51562404 GCGGAGGGGCGCCCGCGCCCCGG - Intronic
1175424640 20:58855662-58855684 GGGGAGGGGCCCCGGGGCCCCGG + Intronic
1175466115 20:59192142-59192164 GGGGAGGGCGGCCCGGGCCCGGG + Exonic
1176125057 20:63471583-63471605 AGGGAGGGGCGTCGGCGCCGAGG + Intronic
1176549301 21:8214497-8214519 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1176557194 21:8258720-8258742 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1176568233 21:8397535-8397557 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1176576136 21:8441755-8441777 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1177188118 21:17819677-17819699 GGCGGGGGCCGCAGGCGGCGGGG + Intergenic
1177431694 21:20998282-20998304 GGGGAGGGCGGCGGGGGCGGGGG - Intergenic
1178707979 21:34889983-34890005 GGCGAGGGACCCCCGCGCCGGGG - Intronic
1178914583 21:36699396-36699418 GGTGGGGGCGGCCGGCGCGGAGG - Exonic
1179810458 21:43865904-43865926 GGGGAGGGCTGCGGGGCCCGGGG + Intronic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180139050 21:45880290-45880312 GGGGAGCGCCTGGGGCGCCGCGG + Intronic
1180161537 21:46000587-46000609 GGGGAGGGCGGCCGGGGAGGCGG + Intronic
1180949526 22:19714878-19714900 GGTGAGGGCCGGCGGGGGCGGGG - Intronic
1181314755 22:21963962-21963984 GGGGATGGTCGCCGGCGTCATGG + Exonic
1183368643 22:37420080-37420102 GGGGTGGGCCGCGGGGGACGGGG + Intronic
1183393920 22:37560927-37560949 GGGGCGGGCAGCGGGCGACGCGG + Intronic
1183831776 22:40422029-40422051 GGGCAGGGCTGCCGGGGCTGTGG + Intronic
1184152986 22:42649265-42649287 GGGAGGGGGCGCCGGGGCCGCGG - Intronic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1184897981 22:47423390-47423412 GGGGAGAGCCCCCTGCGCCTTGG + Intergenic
1185058176 22:48591998-48592020 GGGGAGGTGCCCCGGGGCCGTGG - Intronic
1185088123 22:48751716-48751738 GGCCCGGGCCGCCGGAGCCGGGG - Intronic
1185397683 22:50601026-50601048 GGGGTGGGGCGCCCGAGCCGAGG - Intronic
1185420282 22:50731066-50731088 GGCGTGGGCCGGGGGCGCCGGGG - Intergenic
1203254186 22_KI270733v1_random:130813-130835 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1203262242 22_KI270733v1_random:175892-175914 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
950193385 3:10992933-10992955 GGAAAGGGCGGCCGGCGTCGGGG + Intronic
952768496 3:36976292-36976314 GGAGATGGTCCCCGGCGCCGCGG + Intergenic
953399609 3:42601079-42601101 GGGGAGCGCTGCTGGGGCCGAGG + Intronic
954763994 3:52897645-52897667 GGGGAGAGCTGCCGCGGCCGAGG - Intergenic
955281235 3:57596951-57596973 GGGGAGGGGCGCCGGGTCGGGGG - Intronic
956468569 3:69542338-69542360 GAGGAAGGCAGCCGCCGCCGGGG - Intronic
961077043 3:123992050-123992072 GGGGAGGGCAGCAGCGGCCGGGG + Intronic
961260100 3:125595347-125595369 GGGGCGGGACGCCGGCTCCCGGG + Intergenic
961307533 3:125969250-125969272 GGGGAGGGCAGCAGCGGCCGGGG - Exonic
961545350 3:127629314-127629336 CGGGAGGGCGGGCGGCGGCGTGG + Intronic
961735859 3:129001832-129001854 GGGGCAGACGGCCGGCGCCGCGG - Exonic
961827621 3:129606966-129606988 GGGGAGGGACCCTGGGGCCGCGG - Intergenic
962222335 3:133574128-133574150 GGCGAGTGCCGCGGGCGCAGCGG + Exonic
963939733 3:151086420-151086442 GGGGAGGGCCACCCTCGCCTTGG + Intronic
965520378 3:169663803-169663825 GGGGAGGGCGGCGGGGGGCGGGG + Intergenic
966849339 3:184155279-184155301 GCGGAGAGGCGCCGGCGTCGCGG - Intronic
968471950 4:786458-786480 GGGGAGGGGCGGGGGCTCCGCGG + Exonic
968701591 4:2060281-2060303 GGGGAAGACAGCCGGCGCCGCGG + Intronic
968965116 4:3765829-3765851 GGGGCGGGCCGCGGGCCCTGGGG - Intergenic
969099631 4:4759244-4759266 TGGGAAGGCCGCCGGTGCTGCGG + Intergenic
969360121 4:6658044-6658066 GGGAAGGGGCGGCGGCGCTGTGG + Intergenic
970332651 4:15002348-15002370 GGGGAGGGGCGACGGGGACGCGG + Intergenic
971244127 4:24913057-24913079 GAGGAGGGGCGCGGCCGCCGGGG + Intronic
974047244 4:56908251-56908273 GGGGAGGGCCGCCCGGGCGGCGG + Intronic
974977374 4:68906945-68906967 GGGGAGGGGCACCGGGGACGCGG + Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978741847 4:112145742-112145764 GGGGAGGGGCGGCGGCGAAGCGG + Intronic
982068266 4:151673257-151673279 GGGGGGGGCCGCGGGAGGCGTGG + Intronic
983904408 4:173169138-173169160 GGGGCGGGCCGGCGGCGGCCAGG - Intronic
983927416 4:173416704-173416726 GGAGAGGGCCCCAGGAGCCGGGG - Intergenic
985692131 5:1319360-1319382 GGGGGGGGCAGCCGGCGGCCAGG + Intronic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
988825348 5:34929789-34929811 CGGGCGGGCGGCCGGCGCTGGGG - Exonic
993168264 5:84384182-84384204 GGCGAGCGCCGCTGGCGGCGCGG - Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
998295650 5:140966806-140966828 GGCATGGGCCGCCGGAGCCGTGG - Exonic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1000194392 5:158943749-158943771 GGGGAGGGCAGGGGGCGCCAGGG + Intronic
1001065111 5:168529676-168529698 GGCGGGGGCGGCCGGGGCCGGGG + Exonic
1001529951 5:172454599-172454621 GGGGCGGGCCGGCGGCGCGGGGG - Intergenic
1002055759 5:176597174-176597196 GGGGAAGGCGGGCGGCGCGGCGG + Exonic
1002428008 5:179187074-179187096 GGAGAGGGCAGCCGGCTCTGGGG - Intronic
1002576851 5:180178909-180178931 GGGGAGGGGCGCAGGTGCCAAGG + Intronic
1002580874 5:180208942-180208964 GGGGAGGGCTGCCGGCGGCGCGG - Intronic
1003049300 6:2765604-2765626 GGGGAGGGCGGCGGCCGCCATGG + Exonic
1003325089 6:5085197-5085219 GGGGAGGGCCGGGGGCGGGGAGG - Exonic
1004395688 6:15245238-15245260 GGGGAGGGGGGCCGGGGCCCGGG + Intergenic
1005348294 6:24910994-24911016 CGGCAGGGCAGCCGGCGCTGGGG - Intronic
1005825226 6:29628142-29628164 GGGGAGGGAAGCGAGCGCCGAGG + Intronic
1006043223 6:31271717-31271739 GAGGGGAGCCGCGGGCGCCGTGG - Exonic
1007264718 6:40587720-40587742 GGGCAGGGCAGCGGGCGCAGAGG - Intergenic
1007383542 6:41505250-41505272 GGGGCGGGCGGCCCGCGCGGTGG + Intergenic
1007406085 6:41637202-41637224 CGAGAGCGCTGCCGGCGCCGTGG + Intronic
1007775735 6:44223494-44223516 GGGCGGGGCCGCGGGCGTCGGGG + Intronic
1008160392 6:48068873-48068895 GGGGCGGGCGGCGGGCGCCGCGG + Intergenic
1010428164 6:75749145-75749167 GGGCGGGGGCGCCGGGGCCGCGG - Intergenic
1012398724 6:98827676-98827698 GGGAAGGGGGGCCGGCCCCGCGG - Intergenic
1013225578 6:108117831-108117853 GGGCAGGGCCGCGGGAGGCGCGG - Intronic
1015786254 6:136923185-136923207 TGGGAGGGCCGCCTGAGCCTGGG + Intronic
1017717212 6:157221416-157221438 GAGAACGGCTGCCGGCGCCGCGG - Intergenic
1019385708 7:754935-754957 GGGGAGGGCCTGCGGCCCGGGGG - Intronic
1019409124 7:899004-899026 GGGGCGGGCGGCCGGCGGCCTGG - Intronic
1019474081 7:1235767-1235789 CGGGCTGGCCGCCGGGGCCGAGG - Intronic
1019525341 7:1478116-1478138 GGAGAGTGCGGCCGGGGCCGGGG + Intronic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1019732873 7:2637317-2637339 GGGGAGAGCCGCCGTGGCCTGGG - Intronic
1022090085 7:27102281-27102303 TGGGGCGGCCGCCAGCGCCGTGG + Exonic
1022095674 7:27139637-27139659 GGCGCCGGCCGCGGGCGCCGAGG - Intronic
1022524598 7:31028947-31028969 GGGGTGGGGCGCCGGAGCCAGGG + Intergenic
1022714926 7:32891211-32891233 CGGGAGCCCCGCGGGCGCCGAGG + Intronic
1023860895 7:44217272-44217294 GGGGAGGCCAGCCAGCACCGTGG + Exonic
1023881799 7:44325144-44325166 GGGCAGGGCCGCGCGCGCTGAGG + Intronic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1024521075 7:50304501-50304523 GGCGGGGGCGGCCGGCGCGGAGG + Intronic
1024930729 7:54664690-54664712 AGGGAGGGCCCCAGGCGCAGCGG + Intergenic
1026769723 7:73187952-73187974 GGGCAGGGCGGCCTGCGCTGGGG + Intergenic
1026837378 7:73647815-73647837 GGGGCGGGCGGCGGGCGGCGGGG + Intergenic
1027010591 7:74741334-74741356 GGGCAGGGCGGCCTGCGCTGGGG + Intronic
1027077451 7:75204706-75204728 GGGCAGGGCGGCCTGCGCTGGGG - Intergenic
1027151857 7:75738968-75738990 GGGCGGGGCGGGCGGCGCCGTGG - Intergenic
1027239528 7:76318188-76318210 GGGGAAGGCGGCCGCCCCCGGGG + Intergenic
1030033299 7:105388452-105388474 GGGGAGGGGCGCGCGGGCCGCGG - Intronic
1031986551 7:128167708-128167730 GGCGAGGGCGGCTGGCGCGGGGG + Intergenic
1032037306 7:128530663-128530685 GGGGCGGGCCGGCGGCTCCGGGG + Intergenic
1032074534 7:128830241-128830263 GGGGAGGGGCGGCGGGGGCGGGG + Intergenic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033186507 7:139231627-139231649 GGGCGGAGCCGCCGGCCCCGCGG + Exonic
1033366074 7:140673297-140673319 AGGGCGGGCCGCCTGGGCCGCGG + Exonic
1034182121 7:149147335-149147357 GGGGAGGGGCGGAGGCGACGCGG + Intronic
1034263601 7:149771697-149771719 GGGGAGGGGCGGGGGAGCCGCGG - Intronic
1034435216 7:151060031-151060053 TGGGAGGGCCGGCGGCGCCTCGG - Intronic
1034478458 7:151302372-151302394 GGGGAGGGCCCCAGGCAGCGTGG - Intergenic
1034983620 7:155494272-155494294 GCCGAGGGCCGCAGGCACCGTGG + Intronic
1035241054 7:157529414-157529436 GAGGAGGGCCGTCGGTGACGAGG - Intergenic
1035701427 8:1641901-1641923 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701476 8:1642056-1642078 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701523 8:1642211-1642233 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701533 8:1642242-1642264 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701553 8:1642304-1642326 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701572 8:1642366-1642388 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701621 8:1642521-1642543 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701651 8:1642614-1642636 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701670 8:1642676-1642698 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701707 8:1642801-1642823 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701765 8:1642987-1643009 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701783 8:1643049-1643071 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701793 8:1643080-1643102 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701813 8:1643142-1643164 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701823 8:1643173-1643195 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701861 8:1643297-1643319 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701891 8:1643390-1643412 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701936 8:1643545-1643567 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701955 8:1643607-1643629 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701983 8:1643700-1643722 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035701993 8:1643731-1643753 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702012 8:1643793-1643815 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702022 8:1643824-1643846 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702032 8:1643855-1643877 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702051 8:1643917-1643939 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702061 8:1643948-1643970 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702080 8:1644010-1644032 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1035702107 8:1644103-1644125 GGTGAGGGCCGGCGGGGTCGAGG - Intronic
1036723713 8:11201018-11201040 GGGGTTGGCGGCCGGCGCCGGGG + Exonic
1037877530 8:22555248-22555270 TGGGAGGTCCTCCGGCGCCCAGG - Intronic
1038204953 8:25457883-25457905 GGGGAGGGCCGCGGTCACCTGGG - Intronic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1040480657 8:47823241-47823263 TGGGAGGACCGCCGGAGCCTGGG + Intronic
1041259193 8:56005447-56005469 AGGGAGGGAGGCCAGCGCCGAGG - Intronic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1049457338 8:142700402-142700424 GGGGAGCCCCGCCCGCCCCGGGG - Exonic
1049561871 8:143316157-143316179 AGGGAGGGTGGCCGGCCCCGTGG - Intronic
1049562123 8:143317115-143317137 GGGGAGTGCGGTGGGCGCCGGGG + Intronic
1049573206 8:143379078-143379100 GGTGAGGGCGGCCCGGGCCGCGG + Exonic
1049585415 8:143430527-143430549 GGCGCGGGGCGGCGGCGCCGAGG + Intergenic
1049616428 8:143577599-143577621 GGGATGGGCCCCCAGCGCCGGGG - Intronic
1049686006 8:143939630-143939652 GGGGCGGGCCGGCCTCGCCGGGG - Intronic
1049708094 8:144051883-144051905 GGGGAGGGCCGCGAGGGCTGGGG + Intronic
1049789450 8:144466138-144466160 GAGGAGGGTCGCGGGAGCCGTGG + Exonic
1049936562 9:505354-505376 GGGGAGGGGCGTGGGCGCTGCGG + Intronic
1050472576 9:6008130-6008152 GGGGTGGGGCGCCGAGGCCGCGG - Intergenic
1051174012 9:14346113-14346135 GGGGCGCGCCGCGGGCGCGGGGG + Intronic
1052048362 9:23820969-23820991 GTGTAGGGCCGCGGGCGCCCAGG - Intronic
1053129228 9:35605678-35605700 GGGAGGGGCCCCCGGGGCCGGGG + Exonic
1053240061 9:36487787-36487809 GGGGCGGGAGGGCGGCGCCGAGG + Intergenic
1055611603 9:78030988-78031010 GGGGCGAACCGCGGGCGCCGGGG + Intronic
1056992343 9:91423719-91423741 GGGCCGGGCCTCCGGGGCCGCGG + Exonic
1057146820 9:92764375-92764397 GGGGTGGGCCGCCGGGGCGGAGG - Intronic
1057337353 9:94166348-94166370 GGAGAGGGCCGTCGCGGCCGTGG - Intergenic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1058058463 9:100472974-100472996 GGGCAGGGGCGCGGGGGCCGGGG - Intronic
1058663014 9:107283414-107283436 GGGGAAGGCCGCAGTCGCGGAGG + Exonic
1060106715 9:120877228-120877250 GGGGCGGGGCGGGGGCGCCGCGG + Exonic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1060549357 9:124477780-124477802 GGGGAGGGGCGCTGGCCCCGGGG - Intronic
1060996563 9:127877560-127877582 GGGGAGGGGCAGCGGCACCGGGG - Intronic
1061365989 9:130172641-130172663 GGCGGGGGCCGCGGCCGCCGAGG + Exonic
1061438088 9:130579446-130579468 GGGGCGGGACGGCAGCGCCGGGG - Intronic
1062337556 9:136078966-136078988 GGAGAGGGGCGGCGGCGGCGCGG - Intronic
1062389290 9:136327648-136327670 CGGGAGCGCCCCCCGCGCCGTGG - Exonic
1062462023 9:136666089-136666111 GGGGAGGGCCGGGGTCGCCGCGG + Intronic
1062609912 9:137369084-137369106 GGGGAGGGGCGCAGGGCCCGGGG + Intronic
1062633955 9:137480281-137480303 GGGGAGGGCCGGTGGAGCTGGGG - Intronic
1203470587 Un_GL000220v1:113957-113979 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1203478408 Un_GL000220v1:157929-157951 GGGGTGGGCGGGCGGGGCCGGGG + Intergenic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1186496484 X:10015672-10015694 GGCGGGGGGCGCCGGCGGCGCGG - Exonic
1186669951 X:11758188-11758210 GGGGAGGGCGGGCGGGGGCGGGG - Exonic
1196828645 X:119759462-119759484 GTGGAGGGCCGCGAGCGCAGTGG + Exonic
1198100044 X:133415317-133415339 GGGAAGGGTGGCAGGCGCCGCGG + Exonic
1198515860 X:137405981-137406003 GGTGAGGGCCACCAGAGCCGCGG - Intergenic
1199699107 X:150363468-150363490 GGGGCGGGCGGCCGCCGGCGCGG - Exonic
1200128769 X:153830218-153830240 AGGTAGGGCCGCCGGCGCTGCGG - Exonic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic
1200306029 X:155026896-155026918 AGGGAGGGCCGGGCGCGCCGCGG - Exonic