ID: 998374817

View in Genome Browser
Species Human (GRCh38)
Location 5:141683200-141683222
Sequence CTGTTTGTATGAGAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998374814_998374817 -9 Left 998374814 5:141683186-141683208 CCGGCTGTGTTTTCCTGTTTGTA No data
Right 998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998374817 Original CRISPR CTGTTTGTATGAGAGGAAGT TGG Intergenic
No off target data available for this crispr