ID: 998375760

View in Genome Browser
Species Human (GRCh38)
Location 5:141689525-141689547
Sequence GATCTCAGTGGCATGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998375760_998375767 23 Left 998375760 5:141689525-141689547 CCATTTCTCATGCCACTGAGATC No data
Right 998375767 5:141689571-141689593 TGACTTCTATGCCACCCTACAGG No data
998375760_998375768 24 Left 998375760 5:141689525-141689547 CCATTTCTCATGCCACTGAGATC No data
Right 998375768 5:141689572-141689594 GACTTCTATGCCACCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998375760 Original CRISPR GATCTCAGTGGCATGAGAAA TGG (reversed) Intergenic
No off target data available for this crispr