ID: 998382144

View in Genome Browser
Species Human (GRCh38)
Location 5:141733370-141733392
Sequence AAACCAAGGATTGCAGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998382142_998382144 9 Left 998382142 5:141733338-141733360 CCACAGAGGTAAGATTGGGGTGA No data
Right 998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998382144 Original CRISPR AAACCAAGGATTGCAGCCAC CGG Intergenic
No off target data available for this crispr