ID: 998383808

View in Genome Browser
Species Human (GRCh38)
Location 5:141744433-141744455
Sequence TTCAAGGAAGGAGGCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383808_998383819 18 Left 998383808 5:141744433-141744455 CCAAGGTGGCCTCCTTCCTTGAA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383808_998383816 4 Left 998383808 5:141744433-141744455 CCAAGGTGGCCTCCTTCCTTGAA No data
Right 998383816 5:141744460-141744482 CAAATGAAGCAGTCCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383808 Original CRISPR TTCAAGGAAGGAGGCCACCT TGG (reversed) Intergenic
No off target data available for this crispr