ID: 998383809

View in Genome Browser
Species Human (GRCh38)
Location 5:141744442-141744464
Sequence ATTTGGGGGTTCAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383809_998383816 -5 Left 998383809 5:141744442-141744464 CCTCCTTCCTTGAACCCCCAAAT No data
Right 998383816 5:141744460-141744482 CAAATGAAGCAGTCCCTTCCAGG No data
998383809_998383819 9 Left 998383809 5:141744442-141744464 CCTCCTTCCTTGAACCCCCAAAT No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383809 Original CRISPR ATTTGGGGGTTCAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr