ID: 998383810

View in Genome Browser
Species Human (GRCh38)
Location 5:141744445-141744467
Sequence TTCATTTGGGGGTTCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383810_998383816 -8 Left 998383810 5:141744445-141744467 CCTTCCTTGAACCCCCAAATGAA No data
Right 998383816 5:141744460-141744482 CAAATGAAGCAGTCCCTTCCAGG No data
998383810_998383819 6 Left 998383810 5:141744445-141744467 CCTTCCTTGAACCCCCAAATGAA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383810 Original CRISPR TTCATTTGGGGGTTCAAGGA AGG (reversed) Intergenic
No off target data available for this crispr