ID: 998383811

View in Genome Browser
Species Human (GRCh38)
Location 5:141744449-141744471
Sequence CTGCTTCATTTGGGGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383811_998383819 2 Left 998383811 5:141744449-141744471 CCTTGAACCCCCAAATGAAGCAG No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383811 Original CRISPR CTGCTTCATTTGGGGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr