ID: 998383812

View in Genome Browser
Species Human (GRCh38)
Location 5:141744456-141744478
Sequence GAAGGGACTGCTTCATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383812_998383819 -5 Left 998383812 5:141744456-141744478 CCCCCAAATGAAGCAGTCCCTTC No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383812 Original CRISPR GAAGGGACTGCTTCATTTGG GGG (reversed) Intergenic
No off target data available for this crispr