ID: 998383813

View in Genome Browser
Species Human (GRCh38)
Location 5:141744457-141744479
Sequence GGAAGGGACTGCTTCATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383813_998383819 -6 Left 998383813 5:141744457-141744479 CCCCAAATGAAGCAGTCCCTTCC No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383813 Original CRISPR GGAAGGGACTGCTTCATTTG GGG (reversed) Intergenic
No off target data available for this crispr