ID: 998383814

View in Genome Browser
Species Human (GRCh38)
Location 5:141744458-141744480
Sequence TGGAAGGGACTGCTTCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383814_998383819 -7 Left 998383814 5:141744458-141744480 CCCAAATGAAGCAGTCCCTTCCA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383814 Original CRISPR TGGAAGGGACTGCTTCATTT GGG (reversed) Intergenic
No off target data available for this crispr