ID: 998383815

View in Genome Browser
Species Human (GRCh38)
Location 5:141744459-141744481
Sequence CTGGAAGGGACTGCTTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383815_998383819 -8 Left 998383815 5:141744459-141744481 CCAAATGAAGCAGTCCCTTCCAG No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998383815 Original CRISPR CTGGAAGGGACTGCTTCATT TGG (reversed) Intergenic
No off target data available for this crispr