ID: 998383819

View in Genome Browser
Species Human (GRCh38)
Location 5:141744474-141744496
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998383808_998383819 18 Left 998383808 5:141744433-141744455 CCAAGGTGGCCTCCTTCCTTGAA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383813_998383819 -6 Left 998383813 5:141744457-141744479 CCCCAAATGAAGCAGTCCCTTCC No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383809_998383819 9 Left 998383809 5:141744442-141744464 CCTCCTTCCTTGAACCCCCAAAT No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383812_998383819 -5 Left 998383812 5:141744456-141744478 CCCCCAAATGAAGCAGTCCCTTC No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383814_998383819 -7 Left 998383814 5:141744458-141744480 CCCAAATGAAGCAGTCCCTTCCA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383811_998383819 2 Left 998383811 5:141744449-141744471 CCTTGAACCCCCAAATGAAGCAG No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383810_998383819 6 Left 998383810 5:141744445-141744467 CCTTCCTTGAACCCCCAAATGAA No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data
998383815_998383819 -8 Left 998383815 5:141744459-141744481 CCAAATGAAGCAGTCCCTTCCAG No data
Right 998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type