ID: 998385145

View in Genome Browser
Species Human (GRCh38)
Location 5:141753259-141753281
Sequence GCCGACGCCGGAGCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385145_998385163 30 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385145_998385162 29 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385162 5:141753311-141753333 GAACGTCCCTCCCCGGGGCGGGG No data
998385145_998385160 27 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385160 5:141753309-141753331 AGGAACGTCCCTCCCCGGGGCGG No data
998385145_998385148 -10 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385148 5:141753272-141753294 CGGCGTCGGCAGCACCCGTTGGG No data
998385145_998385159 24 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385159 5:141753306-141753328 GAGAGGAACGTCCCTCCCCGGGG No data
998385145_998385156 7 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385156 5:141753289-141753311 GTTGGGGGTGAGGACGGGAGAGG No data
998385145_998385151 -3 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385151 5:141753279-141753301 GGCAGCACCCGTTGGGGGTGAGG No data
998385145_998385150 -8 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385150 5:141753274-141753296 GCGTCGGCAGCACCCGTTGGGGG No data
998385145_998385161 28 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385145_998385153 2 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data
998385145_998385149 -9 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385149 5:141753273-141753295 GGCGTCGGCAGCACCCGTTGGGG No data
998385145_998385158 23 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385158 5:141753305-141753327 GGAGAGGAACGTCCCTCCCCGGG No data
998385145_998385152 1 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385152 5:141753283-141753305 GCACCCGTTGGGGGTGAGGACGG No data
998385145_998385157 22 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385145 Original CRISPR GCCGACGCCGGAGCCAGAGC TGG (reversed) Intergenic