ID: 998385146

View in Genome Browser
Species Human (GRCh38)
Location 5:141753271-141753293
Sequence CCAACGGGTGCTGCCGACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385146_998385161 16 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385146_998385157 10 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data
998385146_998385160 15 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385160 5:141753309-141753331 AGGAACGTCCCTCCCCGGGGCGG No data
998385146_998385159 12 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385159 5:141753306-141753328 GAGAGGAACGTCCCTCCCCGGGG No data
998385146_998385164 19 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385164 5:141753313-141753335 ACGTCCCTCCCCGGGGCGGGGGG No data
998385146_998385172 29 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385172 5:141753323-141753345 CCGGGGCGGGGGGTGGTGTTGGG No data
998385146_998385165 22 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385165 5:141753316-141753338 TCCCTCCCCGGGGCGGGGGGTGG No data
998385146_998385158 11 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385158 5:141753305-141753327 GGAGAGGAACGTCCCTCCCCGGG No data
998385146_998385156 -5 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385156 5:141753289-141753311 GTTGGGGGTGAGGACGGGAGAGG No data
998385146_998385153 -10 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data
998385146_998385163 18 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385146_998385170 28 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385170 5:141753322-141753344 CCCGGGGCGGGGGGTGGTGTTGG No data
998385146_998385162 17 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385162 5:141753311-141753333 GAACGTCCCTCCCCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385146 Original CRISPR CCAACGGGTGCTGCCGACGC CGG (reversed) Intergenic