ID: 998385153

View in Genome Browser
Species Human (GRCh38)
Location 5:141753284-141753306
Sequence CACCCGTTGGGGGTGAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385141_998385153 14 Left 998385141 5:141753247-141753269 CCTTCCGTGGATCCAGCTCTGGC No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data
998385146_998385153 -10 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data
998385145_998385153 2 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data
998385142_998385153 10 Left 998385142 5:141753251-141753273 CCGTGGATCCAGCTCTGGCTCCG No data
Right 998385153 5:141753284-141753306 CACCCGTTGGGGGTGAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385153 Original CRISPR CACCCGTTGGGGGTGAGGAC GGG Intergenic