ID: 998385155

View in Genome Browser
Species Human (GRCh38)
Location 5:141753287-141753309
Sequence TCTCCCGTCCTCACCCCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385155_998385164 3 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385164 5:141753313-141753335 ACGTCCCTCCCCGGGGCGGGGGG No data
998385155_998385172 13 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385172 5:141753323-141753345 CCGGGGCGGGGGGTGGTGTTGGG No data
998385155_998385173 19 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385173 5:141753329-141753351 CGGGGGGTGGTGTTGGGAAGCGG No data
998385155_998385174 20 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385174 5:141753330-141753352 GGGGGGTGGTGTTGGGAAGCGGG No data
998385155_998385159 -4 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385159 5:141753306-141753328 GAGAGGAACGTCCCTCCCCGGGG No data
998385155_998385163 2 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385155_998385162 1 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385162 5:141753311-141753333 GAACGTCCCTCCCCGGGGCGGGG No data
998385155_998385170 12 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385170 5:141753322-141753344 CCCGGGGCGGGGGGTGGTGTTGG No data
998385155_998385160 -1 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385160 5:141753309-141753331 AGGAACGTCCCTCCCCGGGGCGG No data
998385155_998385161 0 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385155_998385175 25 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385175 5:141753335-141753357 GTGGTGTTGGGAAGCGGGAGAGG No data
998385155_998385165 6 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385165 5:141753316-141753338 TCCCTCCCCGGGGCGGGGGGTGG No data
998385155_998385158 -5 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385158 5:141753305-141753327 GGAGAGGAACGTCCCTCCCCGGG No data
998385155_998385157 -6 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385155 Original CRISPR TCTCCCGTCCTCACCCCCAA CGG (reversed) Intergenic