ID: 998385157

View in Genome Browser
Species Human (GRCh38)
Location 5:141753304-141753326
Sequence GGGAGAGGAACGTCCCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385146_998385157 10 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data
998385154_998385157 -5 Left 998385154 5:141753286-141753308 CCCGTTGGGGGTGAGGACGGGAG No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data
998385145_998385157 22 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data
998385155_998385157 -6 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data
998385142_998385157 30 Left 998385142 5:141753251-141753273 CCGTGGATCCAGCTCTGGCTCCG No data
Right 998385157 5:141753304-141753326 GGGAGAGGAACGTCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385157 Original CRISPR GGGAGAGGAACGTCCCTCCC CGG Intergenic