ID: 998385161

View in Genome Browser
Species Human (GRCh38)
Location 5:141753310-141753332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385145_998385161 28 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385146_998385161 16 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385155_998385161 0 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data
998385154_998385161 1 Left 998385154 5:141753286-141753308 CCCGTTGGGGGTGAGGACGGGAG No data
Right 998385161 5:141753310-141753332 GGAACGTCCCTCCCCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type