ID: 998385163

View in Genome Browser
Species Human (GRCh38)
Location 5:141753312-141753334
Sequence AACGTCCCTCCCCGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385146_998385163 18 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385145_998385163 30 Left 998385145 5:141753259-141753281 CCAGCTCTGGCTCCGGCGTCGGC No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385155_998385163 2 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data
998385154_998385163 3 Left 998385154 5:141753286-141753308 CCCGTTGGGGGTGAGGACGGGAG No data
Right 998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385163 Original CRISPR AACGTCCCTCCCCGGGGCGG GGG Intergenic
No off target data available for this crispr