ID: 998385164

View in Genome Browser
Species Human (GRCh38)
Location 5:141753313-141753335
Sequence ACGTCCCTCCCCGGGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385155_998385164 3 Left 998385155 5:141753287-141753309 CCGTTGGGGGTGAGGACGGGAGA No data
Right 998385164 5:141753313-141753335 ACGTCCCTCCCCGGGGCGGGGGG No data
998385146_998385164 19 Left 998385146 5:141753271-141753293 CCGGCGTCGGCAGCACCCGTTGG No data
Right 998385164 5:141753313-141753335 ACGTCCCTCCCCGGGGCGGGGGG No data
998385154_998385164 4 Left 998385154 5:141753286-141753308 CCCGTTGGGGGTGAGGACGGGAG No data
Right 998385164 5:141753313-141753335 ACGTCCCTCCCCGGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385164 Original CRISPR ACGTCCCTCCCCGGGGCGGG GGG Intergenic