ID: 998385412

View in Genome Browser
Species Human (GRCh38)
Location 5:141754510-141754532
Sequence CTGGGGGTATGGAGGAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998385412_998385423 8 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385423 5:141754541-141754563 TCAACCACCACCACCACCACAGG No data
998385412_998385431 18 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385431 5:141754551-141754573 CCACCACCACAGGGTGGGGAAGG No data
998385412_998385426 12 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385426 5:141754545-141754567 CCACCACCACCACCACAGGGTGG No data
998385412_998385428 14 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385428 5:141754547-141754569 ACCACCACCACCACAGGGTGGGG No data
998385412_998385433 23 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385433 5:141754556-141754578 ACCACAGGGTGGGGAAGGAGAGG No data
998385412_998385424 9 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385424 5:141754542-141754564 CAACCACCACCACCACCACAGGG No data
998385412_998385427 13 Left 998385412 5:141754510-141754532 CCTTGGTTCCTCCATACCCCCAG No data
Right 998385427 5:141754546-141754568 CACCACCACCACCACAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998385412 Original CRISPR CTGGGGGTATGGAGGAACCA AGG (reversed) Intergenic
No off target data available for this crispr