ID: 998388818

View in Genome Browser
Species Human (GRCh38)
Location 5:141773944-141773966
Sequence GCCCTCCCAAAGCTGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998388818_998388831 23 Left 998388818 5:141773944-141773966 CCAAGCTACAGCTTTGGGAGGGC No data
Right 998388831 5:141773990-141774012 AAGGCATGGGACAACCTCCAGGG No data
998388818_998388824 10 Left 998388818 5:141773944-141773966 CCAAGCTACAGCTTTGGGAGGGC No data
Right 998388824 5:141773977-141773999 TCGCTCCTCCCCCAAGGCATGGG No data
998388818_998388823 9 Left 998388818 5:141773944-141773966 CCAAGCTACAGCTTTGGGAGGGC No data
Right 998388823 5:141773976-141773998 GTCGCTCCTCCCCCAAGGCATGG No data
998388818_998388821 4 Left 998388818 5:141773944-141773966 CCAAGCTACAGCTTTGGGAGGGC No data
Right 998388821 5:141773971-141773993 TGCCTGTCGCTCCTCCCCCAAGG No data
998388818_998388830 22 Left 998388818 5:141773944-141773966 CCAAGCTACAGCTTTGGGAGGGC No data
Right 998388830 5:141773989-141774011 CAAGGCATGGGACAACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998388818 Original CRISPR GCCCTCCCAAAGCTGTAGCT TGG (reversed) Intergenic
No off target data available for this crispr