ID: 998390288

View in Genome Browser
Species Human (GRCh38)
Location 5:141783087-141783109
Sequence CCACAGGGGCAGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998390288_998390301 4 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390288_998390299 -3 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390288_998390304 6 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390304 5:141783116-141783138 CACACTCCCTAGGGCCAGTGGGG No data
998390288_998390303 5 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390303 5:141783115-141783137 CCACACTCCCTAGGGCCAGTGGG No data
998390288_998390298 -4 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390298 5:141783106-141783128 GTGGCCAGGCCACACTCCCTAGG No data
998390288_998390307 16 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998390288 Original CRISPR CCACAGGGGCAGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr