ID: 998390299

View in Genome Browser
Species Human (GRCh38)
Location 5:141783107-141783129
Sequence TGGCCAGGCCACACTCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998390285_998390299 6 Left 998390285 5:141783078-141783100 CCCCACATGCCCTCCACCTCCTG No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390282_998390299 30 Left 998390282 5:141783054-141783076 CCTCCAGAGGGCTCCTCTAAGTG No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390284_998390299 17 Left 998390284 5:141783067-141783089 CCTCTAAGTGTCCCCACATGCCC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390287_998390299 4 Left 998390287 5:141783080-141783102 CCACATGCCCTCCACCTCCTGCC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390283_998390299 27 Left 998390283 5:141783057-141783079 CCAGAGGGCTCCTCTAAGTGTCC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390288_998390299 -3 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390291_998390299 -7 Left 998390291 5:141783091-141783113 CCACCTCCTGCCCCTGTGGCCAG No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390293_998390299 -10 Left 998390293 5:141783094-141783116 CCTCCTGCCCCTGTGGCCAGGCC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390286_998390299 5 Left 998390286 5:141783079-141783101 CCCACATGCCCTCCACCTCCTGC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data
998390290_998390299 -4 Left 998390290 5:141783088-141783110 CCTCCACCTCCTGCCCCTGTGGC No data
Right 998390299 5:141783107-141783129 TGGCCAGGCCACACTCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998390299 Original CRISPR TGGCCAGGCCACACTCCCTA GGG Intergenic
No off target data available for this crispr