ID: 998390301

View in Genome Browser
Species Human (GRCh38)
Location 5:141783114-141783136
Sequence GCCACACTCCCTAGGGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998390293_998390301 -3 Left 998390293 5:141783094-141783116 CCTCCTGCCCCTGTGGCCAGGCC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390285_998390301 13 Left 998390285 5:141783078-141783100 CCCCACATGCCCTCCACCTCCTG No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390288_998390301 4 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390287_998390301 11 Left 998390287 5:141783080-141783102 CCACATGCCCTCCACCTCCTGCC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390294_998390301 -6 Left 998390294 5:141783097-141783119 CCTGCCCCTGTGGCCAGGCCACA No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390290_998390301 3 Left 998390290 5:141783088-141783110 CCTCCACCTCCTGCCCCTGTGGC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390295_998390301 -10 Left 998390295 5:141783101-141783123 CCCCTGTGGCCAGGCCACACTCC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390284_998390301 24 Left 998390284 5:141783067-141783089 CCTCTAAGTGTCCCCACATGCCC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390286_998390301 12 Left 998390286 5:141783079-141783101 CCCACATGCCCTCCACCTCCTGC No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data
998390291_998390301 0 Left 998390291 5:141783091-141783113 CCACCTCCTGCCCCTGTGGCCAG No data
Right 998390301 5:141783114-141783136 GCCACACTCCCTAGGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998390301 Original CRISPR GCCACACTCCCTAGGGCCAG TGG Intergenic
No off target data available for this crispr