ID: 998390307

View in Genome Browser
Species Human (GRCh38)
Location 5:141783126-141783148
Sequence AGGGCCAGTGGGGCAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998390288_998390307 16 Left 998390288 5:141783087-141783109 CCCTCCACCTCCTGCCCCTGTGG No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390285_998390307 25 Left 998390285 5:141783078-141783100 CCCCACATGCCCTCCACCTCCTG No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390297_998390307 0 Left 998390297 5:141783103-141783125 CCTGTGGCCAGGCCACACTCCCT No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390296_998390307 1 Left 998390296 5:141783102-141783124 CCCTGTGGCCAGGCCACACTCCC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390287_998390307 23 Left 998390287 5:141783080-141783102 CCACATGCCCTCCACCTCCTGCC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390291_998390307 12 Left 998390291 5:141783091-141783113 CCACCTCCTGCCCCTGTGGCCAG No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390286_998390307 24 Left 998390286 5:141783079-141783101 CCCACATGCCCTCCACCTCCTGC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390290_998390307 15 Left 998390290 5:141783088-141783110 CCTCCACCTCCTGCCCCTGTGGC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390293_998390307 9 Left 998390293 5:141783094-141783116 CCTCCTGCCCCTGTGGCCAGGCC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390295_998390307 2 Left 998390295 5:141783101-141783123 CCCCTGTGGCCAGGCCACACTCC No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390300_998390307 -7 Left 998390300 5:141783110-141783132 CCAGGCCACACTCCCTAGGGCCA No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data
998390294_998390307 6 Left 998390294 5:141783097-141783119 CCTGCCCCTGTGGCCAGGCCACA No data
Right 998390307 5:141783126-141783148 AGGGCCAGTGGGGCAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998390307 Original CRISPR AGGGCCAGTGGGGCAGCCTG AGG Intergenic
No off target data available for this crispr