ID: 998390803

View in Genome Browser
Species Human (GRCh38)
Location 5:141785944-141785966
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998390803_998390806 -7 Left 998390803 5:141785944-141785966 CCAACCACAGTCAGGTGTACCTG No data
Right 998390806 5:141785960-141785982 GTACCTGTTGGTCTCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998390803 Original CRISPR CAGGTACACCTGACTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr