ID: 998396943

View in Genome Browser
Species Human (GRCh38)
Location 5:141824825-141824847
Sequence GAGTATCCCTGGACACTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998396943_998396950 26 Left 998396943 5:141824825-141824847 CCTAAGAGTGTCCAGGGATACTC No data
Right 998396950 5:141824874-141824896 GCCATGCCGATGCCTCAAGGAGG No data
998396943_998396949 23 Left 998396943 5:141824825-141824847 CCTAAGAGTGTCCAGGGATACTC No data
Right 998396949 5:141824871-141824893 AGAGCCATGCCGATGCCTCAAGG No data
998396943_998396945 -10 Left 998396943 5:141824825-141824847 CCTAAGAGTGTCCAGGGATACTC No data
Right 998396945 5:141824838-141824860 AGGGATACTCCCAGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998396943 Original CRISPR GAGTATCCCTGGACACTCTT AGG (reversed) Intergenic
No off target data available for this crispr