ID: 998397330

View in Genome Browser
Species Human (GRCh38)
Location 5:141827094-141827116
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397330_998397340 28 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397340 5:141827145-141827167 TTGGAGACATTGAGGAAGACAGG No data
998397330_998397337 9 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397337 5:141827126-141827148 TGTTAAAGGCACCTGCTGGTTGG No data
998397330_998397339 20 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
998397330_998397336 5 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data
998397330_998397334 -5 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397334 5:141827112-141827134 CTTGCCTCGTGGCATGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397330 Original CRISPR GCAAGAGTGAACTCAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr