ID: 998397332

View in Genome Browser
Species Human (GRCh38)
Location 5:141827100-141827122
Sequence CACGAGGCAAGAGTGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397332_998397336 -1 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data
998397332_998397342 30 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397342 5:141827153-141827175 ATTGAGGAAGACAGGACAGGTGG No data
998397332_998397341 27 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397341 5:141827150-141827172 GACATTGAGGAAGACAGGACAGG No data
998397332_998397340 22 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397340 5:141827145-141827167 TTGGAGACATTGAGGAAGACAGG No data
998397332_998397337 3 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397337 5:141827126-141827148 TGTTAAAGGCACCTGCTGGTTGG No data
998397332_998397339 14 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397332 Original CRISPR CACGAGGCAAGAGTGAACTC AGG (reversed) Intergenic