ID: 998397335

View in Genome Browser
Species Human (GRCh38)
Location 5:141827116-141827138
Sequence GGTGCCTTTAACATGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397335_998397339 -2 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
998397335_998397340 6 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397340 5:141827145-141827167 TTGGAGACATTGAGGAAGACAGG No data
998397335_998397341 11 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397341 5:141827150-141827172 GACATTGAGGAAGACAGGACAGG No data
998397335_998397342 14 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397342 5:141827153-141827175 ATTGAGGAAGACAGGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397335 Original CRISPR GGTGCCTTTAACATGCCACG AGG (reversed) Intergenic
No off target data available for this crispr