ID: 998397336

View in Genome Browser
Species Human (GRCh38)
Location 5:141827122-141827144
Sequence GGCATGTTAAAGGCACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397329_998397336 28 Left 998397329 5:141827071-141827093 CCTGGGCTGCTTTTAGCAAAGTA No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data
998397330_998397336 5 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data
998397332_998397336 -1 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data
998397331_998397336 2 Left 998397331 5:141827097-141827119 CCACCTGAGTTCACTCTTGCCTC No data
Right 998397336 5:141827122-141827144 GGCATGTTAAAGGCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397336 Original CRISPR GGCATGTTAAAGGCACCTGC TGG Intergenic
No off target data available for this crispr