ID: 998397337

View in Genome Browser
Species Human (GRCh38)
Location 5:141827126-141827148
Sequence TGTTAAAGGCACCTGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397331_998397337 6 Left 998397331 5:141827097-141827119 CCACCTGAGTTCACTCTTGCCTC No data
Right 998397337 5:141827126-141827148 TGTTAAAGGCACCTGCTGGTTGG No data
998397332_998397337 3 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397337 5:141827126-141827148 TGTTAAAGGCACCTGCTGGTTGG No data
998397330_998397337 9 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397337 5:141827126-141827148 TGTTAAAGGCACCTGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397337 Original CRISPR TGTTAAAGGCACCTGCTGGT TGG Intergenic
No off target data available for this crispr